Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DOS2
Systematic Name YDR068W
Strain S288c
Description Protein of unknown function, green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DOS2 YDR068W
AATGCTGGAGGGCCCGGCTAAGACTTAACCCTGAAGCTTCTGTCTTTACAAAATATTATA
TGAATTTATCCCTGAATTTTACATACTATGAAATTTTAGTTTTGGCAAAGAATTTGACAC
GCTACTTACTCTTGCAACTTTTTCAGACGCATTAGCATCATCAACACGCAACTCATCTTT
TGATTCTGTGGCTGTCCTTGCAATATATCGCACGGTAATCCAGGGAACTTTATCCTTTAT
ATCCAGATCGTCAACTTCGATTTCAGAGTTAAAGTTTTCAATGAAATTTCTTTCATGAAT
ATTGATGCTGGAATTATACACCAAAAACTCATTTAGTATGGATACCGTACTCCAATATGA
AAACTTTCTCATACATGCTACTACGAGAGATATTATCAATTCACCATTCGTACAGTGCAT
ATAACAGGGGTAATGCCCTTTATCAATCAGAAATTTAACGCATCGTACTACAACATCGTA
TTCAATAGGAACTGTTTTCTTTTTCCTTTTAATCTTGGGTTTGGTCTTGTCTGCCTTTCT
TTCACTTTGACATTTTATATGAATTGTCTTAATGTTATTTTCTTCACAAAACTTTACCAT
TAGAGGATCAGTGCTCAAAGGTTCTGGTGTCAAAGATAATATGTATTTCAATCTAAGGGT
TCTCAGGAATGGGAGATTGATTTCTCGTGGGTAAGATCCTCTATATAAATTTGGCTGTAC
AGTCGAAAATTGTAACGGAGTCACTAGTGTCATTTTGATACATATAGCTTATTCTAGATG
TGTGAACTGGGTATTCATAGCAATTGTGAACCCATAGTTTATATTGGTACTCCTTTCCTT
CTTAACAGAGTCTCTTTTTTTCTTTCGCATTTTTTTTGGCCTTACATCAAATAGCGGTGA
TTAATGATAAAAAGCACTTAGCAGAAGTCATGCAACAAAAAAAGAACACAACATAAGGGT
ACAGCTAGTGAGCTCCATTGCTTCGACGTTTTAGGATAAA
Chr coordinates Chr IV from 583713-584645
w3c xhtml validator w3c css validator