Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPS2
Systematic Name YDR074W
Alias HOG2, PFK3
Strain S288c
Description Phosphatase subunit of the trehalose-6-P synthase/phosphatase complex; involved in the synthesis of storage carbohydrate trehalose; positive regulator of autophagy involved in the dephosphorylation of Rim15p leading to ATG8 induction; expression is induced by stress conditions and repressed by the Ras-cAMP pathway; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPS2 YDR074W
AGGATATTCTTTCTAAACTCTATCTTCTCTTGGCAAGAGTGTTCGAGATATGGTAGAATA
ACTTTGTTTCTCTTCCCTTTTTTATTTTGTTTTTTTTTTTTTACTTTTGCAATTTTAATT
TTGCATTCAGCTACAGGTGTGATTGCATACCCGCAGAGCAAGTACAGGAAGCATAAGAAA
AATAGAATACGAAAAGCAGAAAAAGAAAGGCAAATAACAATCACTCAAGTACTACAACTG
CATGAATTTATCGTATGTAATGTACCCAACGTAAATAATAATATTAGTATTTTAAAATCT
ATGACATCAGATGTAGTTATCTTACTGCCAGCCCTATTAATACTACTTTCTTATTATCTT
CTTCGAGAGCCACCTTCGTCATCGTCGCAGTAAGCATTGTCATCTTCATCATGCACGTCG
GTAACGGAAGCCTAATCTCAATATCTACTAGTTTACTCTACGCCATTTGGAGCGTAGCCC
CTTCTCCTTTTGACTCTCTGACTTTTCCCTCCCCTCCTTCTCTTCTGGCCTAGCCTAACC
TAGTCTAGCCTCGCTGGACCCCCTCCTTCCAACGGTCAACCCCTTCCTTTCTATTCTCTT
CTCGTTCTCTACGTAAGGAACTTGTAAAAGAAAAAATTTGGTGCCATACAGGGAAATCGG
CAGTGAGACGGAGCGGCCGAGGGTCTGATTATAGGGGTTAGTTACGCTCCTACTATGACG
ATCAAGGAGAGACAATCTCGATTCTCATTTTCTTTGGGACAATACGCCTTTAACCCCCCA
TTTTCGGACATCCCTGGAAGTCTCAGCTGATTCATTTAAATACTATCAATTTCCGTGTAC
TTTCGGAGATCTTTCAGTCAGCTTTTCCTTCATCTTTTTCAGTCTAATCTAAGGAAGAAG
AAAAGCACTTCAATACGAATAGCTACCAACGTACCCAGTTCACGTTGAACAAGCAATAGA
AAACCAAAATAACACTGCCTGTCACTATTTCTGTGCCGAA
Chr coordinates Chr IV from 593893-596583
w3c xhtml validator w3c css validator