Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TVP23
Systematic Name YDR084C
Strain S288c
Description Integral membrane protein localized to late Golgi vesicles along with the v-SNARE Tlg2p; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TVP23 YDR084C
ACTCTAATGGATACAGATTCAATTTTTGATGATCTGTTGTCCAAGGAAAATGATAAATAC
GATTTGAGGCGAAGGCAATTAGAAATACGACAAAAGCTCCACGAGACCTCGCACAACGAC
GATGGCAAGGTTTCTTTTCGAGATACCGAAAAGCATAATGTCAATGAAGGTTTGATCGAC
AAGACCATAATCGAAGAATTTTCAAAGCTCGGTGAATATATAATCGACACGAGAAATCAA
CCACCACCAAGATCGTCCAAGAGGCCTTCATTAGATGACAATGAATCTGCACGATACTTC
TACAACATATCGACAGATTTGCGACAGTCTCTGTCAGGTCCAATAAGCTTACCAATGCAT
GTTGGGAACGACATGGTAAATAGGTTGAGAAATGACTGGGAGTATATCAGATTCGAAGAT
AGAAGGAATTCGCTGCCAGATTCCTCATTTGATAAAGTCGAAACACCTCCAAAACCAATA
AAAAAAGATGTCCGGTTTGCAAAAGAAGTATGTTTAGCAAGCACTTGGTCATCGAATGCA
TATGAGAGAGCTAATCCGGAATTCATTATGAATCGCCACAGATTGTTGTGGATGATGAAA
GTACATCCAAGCATGAATAGTGCCATGAATGAGATCAAACTTGAACTTAACTCTTACAAA
AAAAATGAGATGGTTGTCCATGAGAACAGCAAGTGCTTTACACATTATTTAATTTGAGTT
ATTAACGTAACATAATCCAGTTTATTTTTTGCAATAGAAGGCGTCATACATATTTATATA
TCAATGTATACATTCCATTCCAGTTACTTCTTTTGCATCTTGCTTCCTGTTTACCTTGAC
CTCGAACCTATTATTTGTCCGCAATGCGCCTTTGGGTGAAAAGGGATTTCGTTTCCATTT
TAACTGTACATAATGTAAATGTAGAAAAGCGTGGTTCTTAAAGGATTTACGGTTCAATAC
GCTTTTATAAACCTGCTGGTGCTCTAATTACGAATGAAAC
Chr coordinates Chr IV from 614004-613405
w3c xhtml validator w3c css validator