Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VTC5
Systematic Name YDR089W
Strain S288c
Description Protein of unknown function; deletion confers resistance to Nickel
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VTC5 YDR089W
CATTTGGTTTTTGAATTATCCAGGGGTATTGCAAGGAATATCGTGGATCCTGCCATATGA
AGGCGTGGATCTTAATTTATTCACCTTTACTGATCGTACCAAACGAAGTAAGCGTAGAAA
GCTAACCAATTTCCTCTTGTTACAGAGAGAAAACTTTTCTTGTACAGTAAACTGAATATG
CTACGTCGTAGACTTACAATGACGCCGCACTTAGGGATAGTAGTTACCTTGCTCACTTTA
CTGTCGTGATCATTACACCCGTACGTAATCGATGATCATTGCAGGAGAGGGGCACTTTGG
TCTGACATCACTTTTTTTACCTAATCAAATAGATTGGCTTTTATTTGACAGATAAGGTTT
ATGATCTCTTTTTTCGAATGGAAAGTTCCATGCAGGCACCCTTTATCTCATTGTATTTAA
ACTACATATAGAATGGATGGAAACGTGGCAAGTCATATCAGGACGCTTTGAAGACTGATA
ATTAAAAACATTAAACAAGTTTCCAGATATCAGGAAGCGACCAAGCCAATATTCAGAACT
TTCGTTTCGAAAAACACAGTAATATATTATTCTCAAAAATTACCACACTTTTTTTAGGCA
AGGCTGCAAAATAATACCAGAAAAGCAGAGGCGGTTCTTAACTTCTGTGTAAATTCAGTG
CAGGAGGACGGGTGTTGTGTTATTAACTTGCAAGGAAAAGAAAGTTTGTGTCTCCCCTTG
TTCTACGCTAGCGAAATGGGTGTGTGGAAGAGTCAAAACTGAACCAAGAAAAAAAAAAAA
AAAAAAACAAAACAGATAAAAAGATAAACAAAGGCAAGATCAAAAAGCCCTATCGTGAAC
GCTATCAAAGGACTTTTAAAATTCATAAATTAATAGTTCGTCCGTTGCCCTCTTGAATAT
AATAGAGATAGAGTTTAATACTTGCTTTTTACCTTTGCTTTTTTTTTGTATATCTCCATC
TCAGCCCTAGGTAAGGATAGATACGAAGGGTTGTACAATC
Chr coordinates Chr IV from 622112-624721
w3c xhtml validator w3c css validator