Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BMH2
Systematic Name YDR099W
Alias SCD3
Strain S288c
Description 14-3-3 protein, minor isoform; controls proteome at post-transcriptional level, binds proteins and DNA, involved in regulation of many processes including exocytosis, vesicle transport, Ras/MAPK signaling, and rapamycin-sensitive signaling; protein increases in abundance and relative distribution to the nucleus increases upon DNA replication stress; abundance relative to Bmh1p increases during sporulation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BMH2 YDR099W
TATAACATGAGCTCATAAACAAAGTCCCTGTTTATATATATTGATGACTTATATATCTTT
CGCTTCAGCTTCTTCCCTCATTTCTACTTAATATTATCTTTTGAAATTAGCGCGATCAAT
TGCATTCTTTTCCACACCACCTTCAAATTTAAGAATTCATATTTGAATCGAACCGTATGT
TTTACCTCTCAATAACTTGTTTCATTAATAGCTCCTTCCACAACCACCTTCATCTTCTCT
GATTTGAATTATTACCGACATGAATGTTACTCTCCTGAAAATGTTAATTATATCAACTTA
ACAGGCCTTGAAAGTGAAGTGTTATAGTTTCTCTTCCTTTGTTTTTCCCACTTTCTTTTT
TTTATATATATCTTATATTGGTTTAAGCACAGCGGATTGCTTTCTTCTAATACAAGAACT
AGAACATAGGTCCACCCGTGTGATGTTGCATTCTGAAATGTTTAGTTATCTCTGTCAGAA
CAGCGAGGTAACACTTATTTTTGTTACGACCAATCCGTAATTCAAGCGTGGGTATTCATA
TGACCAGAGATAATAATACAGCGAATACTATTGAAATCGTCCCTTTTTTGTTTAGGAAGA
ACGGACAAATCGGTCGTCTGCTCGAAATGATTAGTAGTGTGTCACCCGGATCAGCAAAAT
GACACACACGAAATACGAGGAAAAAGTCGGTCGAAAGGGGCAAATGTTATTATAAGTCCC
TCCAGTAGTCTTTTTTTTTTCAAATATTCATCATCAAAGGTTACGAAATCTTTTGAGCTA
TCTTAAACATTCGTTCTTTTTATCAAATTTCAATTACTAACTTATTTTTTCAAAAAAAAT
TGCCTCTCCCGGTTTTTAATCATTATTTTTTTCGATTGATTAAGGGGGAAAAGCAAAGAA
CGAGAAAACTTGGACAGAAGGTTAATACTCTGACAATTTCAAAACGAAGTAAAAAGAAAA
ATTATCAAATCAACAAAAAGTACCCGTTACAACAAAAAAA
Chr coordinates Chr IV from 653607-654428
w3c xhtml validator w3c css validator