Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MKC7
Systematic Name YDR144C
Alias YPS2
Strain S288c
Description GPI-anchored aspartyl protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; shares functions with Yap3p and Kex2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MKC7 YDR144C
GTTGTTGTTGTTGTTGCTGTGATGAATTAGGGACATTTTCAGTAGGAATAGAAGCTGGAT
TGCTTGAATTTGAATTTGAAGTATTATTGTAGGCTTGCGCAGCCTGTTGTCTTCTCCTAT
TCAGTGTAAGGGCATCATATACCTGTTTGATCTTTGCGGCTTGGAACATCAATTCCTTGC
CCCTAGGAGTAGTTTCACCTACATTTCTTGCTTCAGTCAGTAATGTCCTGAACTTAGCGG
CCATTTCTTGCAACTGTCTCGGTTGCAGTACCATATTTTGCTGAGCTCCTGTGATCGCAT
CAGCGTTACCAGTGCCCGTATTATTATTCGCATTAACACCAGAATTTTCTGGATTGGAAG
ACATTGTCGTATTTTATACACACACTGGCAAAGATTCGGTTATGATTCGAATGCTATTGG
ACAGTCTCCTGTCTTACACTAGCGAACCTATGCGCTATATATGCCCATTATTCATTTGCT
CCGACTTAAGTCTAACACATTTTTTAACAAAATTCGCCGCGTATACTGCCCGGGTAATAC
AGCCAAAATCGTGATATTCATTTGATACGTTTACTTGCAAAGCTGTCATGAATCAAGATT
GTACATTTATATACCATAAGGTGCTCTTCATATTCAACAATGCATTTAATTCATCCTCGC
TACGCTTACTAGACCCTATTTACTAATTAAGACGGGATTCATACACATCGTTTTGCACGT
AGAAAGTTACACGCGTTTTTTTTTTTTTGAAGTTGAAATTTCAGCTACGCATCGAGAAAG
TTTATTTGGCAGTTTTCTTTTAAAGTTTTGAACCTGTTTCAATACCTTATTTCCTACCAT
CTTTCATTATTCAGATAATCACTTTTGGGAGAAATTTGGTTGGCGTCACTCGTTCTTGCT
AAGAAATTGTAATTGGCTAAAAGTATCAACGAGAGAACAAGCTTTTGTCGTTATTCGCTT
GAGCAAATACGTCAAAAATAAACGAAAAAGAAAGAGCTCT
Chr coordinates Chr IV from 746101-744311
w3c xhtml validator w3c css validator