Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPR28
Systematic Name YDR218C
Strain S288c
Description Sporulation-specific homolog of the yeast CDC3/10/11/12 family of bud neck microfilament genes; meiotic septin expressed at high levels during meiotic divisions and ascospore formation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPR28 YDR218C
ATCTACTGAATCGTCTGACTCAATCACAAGATTGAGAAAATCTAATAAAGTCAAGGATAA
AGCCGAACTTTTTGAGAAGTTAATTTTTAGAGATAGCAGACCATTAAAAACAAAGAAAAA
GGACAATCCAAGATTGAAATTATCCAGTTCGTTAAGTGCTAATGACGAAGATTTTAGGAA
AATCATAAGTCCCCCTTCTGACATACTACCGAAAGTTGGCAGAAGGAGCGTCTCAAGAGG
TTATTTAGAGGAGATTGAAAGGCATTATCCCGATTTTAACGGTGAAACAACTAATCCTCT
AGCAATTAAAAGAGTCAACAGTACAAAGATAGCAAATTATGAACAATTAATTATAAAAGA
AAATAGCTCGAACTGTAAAGGAATAACAGAGAAAAATGATGAAAATAAATTTCAAAGAAG
TCACACTTCCCCAGTAATAGAATTATCCAAACCTCATCAAAGAAGCAAATTAAAGGCGGT
TGTTACAGACGGTAATAAGATATGCTATCGCAAAATCGAATTGGATAACCCTAGTGGGTC
GAATACGAATGATCATGTAATCAAACGGCTTGACGCTAATACCGATTTTAATATATAACA
GAAAACGCCTCAAACCGACTTTGCTTGGAAGAGTTTTCTCTGAATTAGCAACGGAACTTC
GAAATGGTTTTAGACAAGCATGCATGGTATGTAGAAACAGTTAAAGAGCGCCGCTACCAT
TTGCACAGATGTACATATAAATAAATGACTTATTTTTTATATTCTATCAATAATAAGACA
ATTTGTGGTTGCCTTTAGAAATTTCGTGGCTTTTTTTCATATATTCTAACTTCAATAAAG
TTTTTTTGATGCGAAATTTGATCGCTCATATTAAGGACGCCTGAAAAAGACATGCGTCTA
CATTTTGTGTCATTCCCATAAGAATAGTAAGAACAGGCATTTTTATAAATCGATACAAAA
AAAGAGCTACTATACGTACATAAAGTCAGTAAATAATCAA
Chr coordinates Chr IV from 905052-903781
w3c xhtml validator w3c css validator