Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRP45
Systematic Name YDR280W
Strain S288c
Description Exosome non-catalytic core component; involved in 3'-5' RNA processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp45p (PM/SCL-75, EXOSC9); protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRP45 YDR280W
ACAGTGTTTCAGCAGATGAACAAGATTACTCCAATTCAAGTGATACTGGTGAAAACCAAA
AAAGCAACAGCAAAACCAATGAGAAATTTCTTACGGTGCGTGATTACCATGATTTCTTAA
CGGATAACCATGACAAGAATTGGGAAAACATTTCTTTAAGTCGTCTCAAGAGTGGCTTAG
CAAAAGTTAGTGAAACCATTGAGGAAGCTGGTGACGTCTATTACAAGATCACATCTGCAA
TGATAACACAATTTTTGTTAGGCAAGGTATCAAAAATTGTAGAAAACTTTCCTCCAAGTA
TCCCTACACTTAAAAATGCCCCAACGGAAATAAAACAGTGCTACAAGGTAGTTATGGCTA
CAAATCTTTTAGTTTCCCTGATTCCAAGGGCGGCCTACCATAATTTACTTACCTTTTCAC
CTACAATGGATAGTGGTTGCCTAAATCCGGATATAAAAGCTAGCTTCATAGAACTCGAAA
ACTACGAGACTACGAACGAATTACAGAATGCTGAAAGAGAATTACTGATGAAAAGTGCCA
TGAATGTAGGCCTAAATTCGAATGGCAGGGTTTCATTGCCAGTGAAAAAAGTTACCAAAA
AAATAGTTCAAAATAAAAAACCAAAAGTAGCCATAGGAAAAGGGGCCATTGATGGATTTT
TTAAACGTAAGTAGCTAGTATCATAATTAAACAGCAATTTGAATGCTATAACTCGGTGGT
GATGACCTCAGTGCGAGATAATTACACAATATTGTCACTACCAACGAATGGGCTACCTTT
TTTTTCCTTTCTCGAATTCAAGAAAAAATTAACAACTTTTCCCTCGATGATGTTAACAAA
TGTCTGAATATAAAGGAATAGGAAACGGTTGCTAGATTGTATTTACCTTACCAACTTTCA
AGTTTTTTTTCTAACTTCCTAACTTTCAGTCTCGATACATTAATCAACAGGACGTAGTGA
TTGCAAAATTGTTCAGAATATACATTAGATTAAAAGACAA
Chr coordinates Chr IV from 1020747-1021664
w3c xhtml validator w3c css validator