Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIM1
Systematic Name YDR317W
Strain S288c
Description Protein of unknown function involved in DNA repair
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>HIM1 YDR317W
ATGAGTTATAGTGTCAACACGTTTACAGATTACGTTTTATTGTTTGGATCATCTAGTTTA
GTAGGAAAAGGTATTTTAGAGAACCTGTTGGACATAAATTTATATATTAAAAATGTTTCG
GACCTACAAGGCAAGCTTGATAGCTTAAGTGAAATAAAGGGAAATGTCGTTCTCAATAAA
CATGTCTTTTGTGTTAATAGAAGGTGCATCAATGAGGAGAAATCATTTATGAAGACCATT
GATTATATAAATATGAGATCAGTTACTTGGCAAGGTGGCAGATATTACTTGAGAAGCAGG
AAAGAAAAAGACACTGAAAAAGTACCGTCTAGTCCTAATACTTTTTGTTATGATAATTTT
GAAGAAGGATTTATTAAAAATACGCCTGAAGAGAGGGGAAAAGATGGTTATTCTTTTGTT
TATAATCAGAAACAGTTCAGTTACACACTACATTATGCATGCGGAAAGGAAAAAGGTATT
GAGATCATTTGTAATTTTACTGTAACGCAATTGATCATCCCCAGATCTGAAACTTGGCCA
AAATTGCTTCCACGGATATTCTCAGGAACACAAAAGCTGGAAAAGTTTGACATTGACAAC
AAAAATTACGTTCCCGGTAGAAGTTTGCCTAGTCTGTGTGATATTAGCACTATGGTGTGC
TCTTTGGGCTCCACCTCAGCTAGAGTGCGGAGAACTCAGGTACCAAGTTCCTTTGCTGAC
TATTACTTACCTTTTAATTTAGCACAAGAATTCACGAATACAACTAACAAAAGGTTGGTG
GTTACAACTGCCTTTAATAATGATTTTCTTAGTAAAACTTTCGAGTATTTTAGAATAAAA
GCTAAATTAGAAAATGACTTGGATGAAGCTTTGCCAAATAAGCTAAAGGAGCTAGTTATT
TTGAGGCCAGGTCCGATGTGTGGACAGCACGGAAATCCTATAAACGTTGAATTGGGTAAA
GAAAACTCCACTTTCTTGGAAAAAATTTTTTATTATCCTCACTATCTTTTAGTTTATAAA
AAGAAATATATCAGTGAGGCCAGAAGGATTGGCTTAAGAACAAAGTTAAGCGAAATAATT
GCTTCCAGTATATATAGGATGCCAGGATCTGCATTATTAGGATACGCTGTCCCAGTTTCA
AAGGTTTCTTATGTTGCCTCTTTGATGGCGATTGAAAGGAAAAGTAAAGAGGCGGGACCT
AAGCTGGAAGTAATTAGCAGTTATCAAATTGATATGATTGTGTGA
Promoter Sequence
Download FASTA
>HIM1 YDR317W
GTACTAAAGCAATGAGACTAAGAGATGAAGTATCAGGAAATCATCTGCACGTATGCTATA
TCGAAACCAAAAAGAATATTGCAGACGTAATGACCAAACCTCTTCCGATAAAAACATTCA
AACTATTAACAAACAAATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGGAAT
AAAAATCCACTATCGTCTATCAACTAATAGTTATATTATCAATATATTATCATATACGGT
GTTAAGATGATGACATAAGTTATGAGAAGCTGTCATCGATGTTAGAGGAAGCTGAAACGC
AAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAATGAGGAATAA
TCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGA
GAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGAATCCCAA
CAATTATCTAATTACCCACATATTTCTCAAATCTCCTATATTACGATCTATTCTTTAGTC
TAAATGTTACCAATCGTTATCCTTTTTTATCATCAATCCGTGCGTTTCAGTTGCTTTTAA
ATTTGATAACGCATTCTTATCATTTATGTCATTTTATTACATCATATATGATAATATTCC
GTCACCTTGAATACTCATCAAGAAACGATAAGTTGTTGTAATTTAACAGTAACTCTGCAT
ATAATTCAACAGGTAAAAACTAACTTTTATATCCTTGAACTTCTTCATTTTTGTGTCTTT
CATTGAAAGTATAATTTTCCTTTTTTTTTTTTGGTTTTCAATACATATAATGATGGGTGA
CATTTTTTGTGTCATTTAGATTAAAAGAAATTTTAAGAAAAATTGACGTATTTAATTTTG
ATCCGCAGTAAACGCTATAAATTCTTTTTAATATAAATGACAGCTTTTTATACATATAGA
CCCTTTGAAGAATATTCCAAACTAGAAAGGTTGATCAGAA
Chr coordinates Chr IV from 1102184-1103428
w3c xhtml validator w3c css validator