Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRPL35
Systematic Name YDR322W
Alias mL38, YmL35
Strain S288c
Description Mitochondrial ribosomal protein of the large subunit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRPL35 YDR322W
CATGGGTGCTGGTTCATTGCCGGAGGAGGTCAATGAAACCTGCATGAAATTGAGTTTGCC
GATCGTATATTCCAAGAGATCGATGGATGGTATGGTGCCTATTGCCAACGTACCAAAGAA
AGGTTCAAAGGAGGATAATCTCATCGCATCTGGTTATCTAAGCCCTGAAAAGAGCAGAAT
CTTGTTACAATTATGTTTGGCAGGTAACTACACGTTGGAAGAAATTAAACATGTTTTCAC
TGGCGTCTATGGTGGGTGAAAATTTTGTAATTTTTTGCATTTGTGTCGATATATATATAT
ATATACATAGACACAGAGATAGAGATATAATTATGCAAGTCCCTGTTAATGCTAGTCTGA
GATGAGTACAGGAATTCTTCATTTAGATTGTCTCGGCTATGTCACTTTTCTATCGTTTCA
CCTGCACATGGCTTTGTCTTGAATACTGAAGCCGTTATTATAGTTCTATCTTCATGTTTT
TAGAGGTTTTTTTTAAATGAGTTTATTAAAATTAAATTTTGAATGTTATTTTTGAATAAA
AATATAAAAAAAATAATATTAATAATTTTTCATTAACTGCTCATGATATCAGTGCATTAG
AAAATCTTTTGGTTCCACTTTTCCTATAAAAATAATTCAAGTTTTATCATTATATCATTT
TTAAATATTTGATTATCATCGCCCGCTGGTCACCGCATTTTTAAAGAATAAATATTACTT
TTTTCGAAATCTGGTGTTTAAATATTTTTAAGAAAGTTAAAAAATAAGGAATATTTGATA
AACAAAAAAAAATTAGCCTTTATATATCCATTTTTGTTTATGTATTCCTTTTTTTATTTT
CTTATGTGTTTGGGATTTACTGTCGCAGTCTTTTCAAATTTTCCGGGCTAAACCGGAAGC
CGGAAGGTCTGGGATAAGACAACAGTATCCAATACAATATCAGACTACAGCAAAAAGCTT
ATTCAGAGATCTTTACAGAAATCAAGGTCACTGCCGAACT
Chr coordinates Chr IV from 1110589-1111692
w3c xhtml validator w3c css validator