Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SVF1
Systematic Name YDR346C
Alias SGI1
Strain S288c
Description Protein with a potential role in cell survival pathways; required for the diauxic growth shift; expression in mammalian cells increases survival under conditions inducing apoptosis; mutant has increased aneuploidy tolerance
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SVF1 YDR346C
AGATTTGAATTTATTAATAATGTTCTGAACTCCATCAAAGACCCAAATGAAGAAATTAGA
GCTGCTTGCAAACGTTCGTTGCCAGTGGTCAATGGCTCATTGCTTATTGTCCTATTGAAA
TCAGGGGTCTGAAGTAGCGCCTCTGGACCTAGCCTGGGGCATTCCTCTGGCGGAGTCCTG
ATACATCCCTGAAGGGAAGACATGCTAAATTTCAAGTTGTACAATGATGACGCATAGTTC
ACGATATGTTTCTTTGAAGCAGATTTCGAATTTTCATGGATGAGAGTTTCTAAGGGTTTT
TGTTGCGCTTCATTTGTACAATCGTTCAATTTTGCATCGAGATATTTCACTCGGTCGAAC
CATGCTTTCTGTAATCCTTCAATAGAAAACAGCCCTTTCAGAGGAGCACCTTCTTTCAGG
TGCTCGAGTGCATACCTAGTAGAGTACTTTCTAATAGCGCGAGCACCAGTAAAGCGAAGC
ATGGTGCTGGAAACCTTAAAATTCAAAAGTATTTAGATTCCCCCAGCTGTTAAATGGCAA
ATCACTGATTGTTTCCAGATCCTAGCTAAAACTGCGGTTCCTCCCACCGTTTCTGCCATA
CTTTTCATCACTTATGCATTATGATATTGCTCTTGAGAGAATCTGAGCAAAATCCTGCAT
AATATAAATCTCACTTTCCACGGAACTTCAGGTCCGGTTTAGTACCGCTTTTTTTCGTTG
TTTTTTTGTTGTTGAGGAGGCAAACTTGCGATGAGTGGGAGAAAACAAAAGCGAAATGAC
AGCTGGTTGATTGAAACATTCGGGGATATCTTGCAAGATTACTCCTTGAGATTCACGAAT
AGCACGGCTTTTCGTTTGTTATATATAGATAGAGCCTGTTGATAGAATTCTTTTGTATTC
GTTTGATAATTTGAAATCTGTAGAAGATCAAAAGATTCAGTCATTTATTGCATCGAATCA
AGAAAAAAGAAACGAATAAGCTTTTGTATAATATAATATA
Chr coordinates Chr IV from 1168659-1167214
w3c xhtml validator w3c css validator