Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SXM1
Systematic Name YDR395W
Alias KAP108
Strain S288c
Description Nuclear transport factor (karyopherin) involved in protein transport between the cytoplasm and nucleoplasm; similar to Nmd5p, Cse1p, Lph2p, and the human cellular apoptosis susceptibility protein, CAS1
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>SXM1 YDR395W
ATGGTACAAGAACAGGCAATTTTGAGCTGCATTGAGCAGACTATGGTTGCTGATGCAAAA
ATTATCAAAGAGGCAGAACAGCAGTTATTTGAGTTCCAGAAGCAACCTGGGTTTACTTCT
TTTCTGCTTAATATAGTGTCTGATGATAATTTTGCGCTAAATGTTCGTCTTTCTTCTGCT
ATTTATTTGAAGAATAAGATTCACAGATCATGGGATACTAAGAGAGAAGATGGTATAAAA
GCTGACGAAAAGCTTTCGATCAAGGAAAGGTTAATCGAGACTTTAGTTAAAAACTGTGAA
AATAACCACATTAGGCCTATCCTGACTGAAACCATAAATGGGATACTTGTTGGTCAGGAA
GATTGGGATTTAGCACCTATTATCAAGAATTTATTATCGAGCGGTGACGCATCGTACATT
TATCCCGGGTTACTACTACTGTTCCAACTTTGTAAAGCTCATAGGTGGGACATGGTTGGG
TCGAGAGATTATATTGATTCTGTTATCGAAGAACTTTTCCCTATTGTGGAAGGGATAGCT
TCTAATATCGGTAGTCAAACGGATTACAGATCTAATGAAATATTGTACCTCATTTTGAAG
TCATTCAAGTATGCATGTTTGAACAACTTGCCTCAATACTTCAGCCAACCTGAAAGAATT
ATGTCATGGGTGCAACTACATTTGTATTTATGTTCCAAACCATTACCAGTCGAAGTAATG
GAACTGGATCCCGCAGATAGGTCCCTAGACAAAAGGGTTAAAGTGAACAAATGGGGGTTC
GGTAACTTAAACAGATTCCTGCAAAGATACAACAAAATTACAAAGGCCATCACCAAGGAA
TTTATCGACTATATCTTCAATACTATTGTTCCTATAATTCTTCGAGAATTTTTTAAGGAT
ATTGAAGCTTGGGGTAATAATTCACTATGGTTATCCGATTCCTCTTTGTATTTCTTAATT
TCATTCCTAGAGAAATGTGTTACAATAGATCAACTTTATCCTTTAATTGAGCCACATTTA
CAAATTATTTTTGAGAACGTCATCTTCCCATGTTTGTGTGCTAATGAACAATCCATCGAA
TTATTAGAAGATGACCAAGAGGAATATACCAGGCGTTATTTTGACATTAACAGAGAAGGC
TCTACGCCAGATGCTGCTTCAGCAGATTTCATATTCTTGATTGGGTCCAAACGTCCTGAG
AAACTGAACAATATTTTACCGTTCATTAATGATATTTTTACTAGATTCGATGCCAATTCC
AGTGATATTAACATGGCATTTAAAGAAGAGGGTGCTTTGAGAACATTGTCTAACTTGTTT
TCGTTTATAGATGAGCCATCCGTTCTGGAGAATATTTTTGGACACTTCATCGTGCCATTG
TTATCGCAGGATAAGTACATGTTTTTGGTTGCAAGAAGTTTGGAAACGATAGCGCTGTAT
TCGGAAGAATTTAAAGATATGAACATATTGTCACAATTATTTGAGTTAACATATACCAAC
TTCTTAAACAGTAACGTTTTACCAGTCCAAATTGAGGCCGCAGATGCCATTAAATGTTTA
ATTGTATCCAATCCTCAAATCCACCCAGCGGTCTCTGCTCATGTTCCAGGTATGATGGAA
AAGCTATTGAAATTGTCTAAAATCTTTGAAATCGATATCTTATCTGAAGTCATGGAAGCA
TTGGTGGAGAGATTTTCAGATGAACTATCCCCATTTGCTAAAGATTTAGCTTCAAACCTA
GTCGAACAATTTTTACGTATTGCTCAAGCATTGGTAGAAAATCCATCGGAAACCTACAGC
GCAAGTGACCAAGAGCAGGAAATCCAGGCCAGTGGATTGTTACAAACAATGACTACTATG
GTCATGTCAATGAATAAAGTTCCATTAATCGAGTCCTTAGCTCCCGTGGTCAAGTTTGTT
GTACTTCATGCACAAATTTCTTTTATTACGGAAGCTGTCGACTTACTGGATGCTTTAACT
ATTTCTTCGCATCTGCTTTATAACCAAATTGCACCACCAATATGGGAGTTGTTACATGAT
ATATTGGATTCTTTCCAAACTTATGCCATGGACTATTTTGAGGCCTACAGTATTTTTTTT
GAAACCATCGTGATGACCGGCTTCCCACAAGATCAAACTTATGTTCAACCTCTGCTAGAA
ATTCTCTCTGCTAAACTGGAAAGTGAAGTTGACTACGACATCGAGCATGTTATGCAAATT
CTAATGTACTTCGCACTGTCCATGAGAGACATTCCATTATTCAGCAAAGCCATCAAAGTA
TCCACTAATGATGAGCTAGGATTGGACTCTAAATGCATCGTTAAACTGGGACTGGCCAAT
TTGTTTGCTAAACCAATCGAAACTTTACAAATAATGGAAAATGAAGGTTTTACTATAAAT
TTCTTTACCAATTGGTTTAATGAAAAGTTCTACAGTGTCTTCGCCATCAAATTACAAGTC
CTGGTCATTTTAACCCTTTTGAAGATGCCTGAAGTTCCTAATAGTGTCAGCCCACTACTA
AATAACCTGACCAATAAACTGGTGGAATTGACATTATCATTGCCAAAGGCAATTAGAAAC
CGTGATGCTGTTACCGAGGGCAAATCCTTAGAAGGAGACCTGACCCCAGAAGAAGAAGAA
GAATACTTTATCGAATGTGATGATGATATGAAGGAGACAGTGTTAGACCAAATTAATGTT
TTCCAGGAAGTACATACCTTTTTCAAGAATTTGCAAAACGAAGATGCCGGTAAGTACGAA
AAAATCATAAATTATCTGGATGAATCTAAGAGAGATTCCTTGCAGGTAATTCTGGAATTT
GTTTCTCAACACTGA
Promoter Sequence
Download FASTA
>SXM1 YDR395W
CAGGTACCGGTAAGACGATGCTTGTTAAAGCCGTCGCCAATAGTACAAAAGCTGCATTCA
TAAGAGTTAATGGCTCCGAATTTGTTCACAAATATCTTGGTGAAGGTCCAAGAATGGTTC
GTGACGTCTTTAGACTCGCCAGGGAAAATGCTCCATCCATTATATTCATAGATGAGGTAG
ATTCCATTGCCACAAAGCGTTTTGATGCTCAAACGGGTTCCGATCGTGAAGTACAGCGTA
TCCTGATTGAGTTGTTGACACAAATGGATGGTTTCGATCAATCCACCAACGTTAAAGTCA
TCATGGCTACAAACAGGGCAGACACATTGGACCCAGCTTTGCTGAGACCAGGCAGATTAG
ATAGAAAGATTGAGTTTCCCTCACTTCGTGATAGGCGTGAACGTCGTTTGATTTTCGGTA
CCATTGCCAGTAAGATGTCCCTTGCCCCAGAAGCGGACTTAGACTCGCTTATTATTCGTA
ACGACTCTCTATCAGGTGCTGTTATTGCAGCGATCATGCAGGAAGCTGGTTTAAGAGCAG
TGAGGAAAAACAGATATGTCATCTTACAAAGCGATCTGGAAGAAGCTTACGCCACTCAAG
TCAAGACAGATAATACCGTCGATAAATTCGACTTCTACAAATGATTACCATATATGCTTC
AACGTAGGTCTACATAAAGTATTACGTACATTTCTATCTAGACAACACTAAATGAAATAA
ATACAGACGCCACTTTTTTATCACGTTTCTTAGCGTTATTCCGCGCGCAACCGGACGTCG
CTAGCCAAGTTTTTCACTTTTTTTTTTCTGTGATATTTTTTTTTCCAAATGAGATGGTAA
GATGAGTACCTATCAACAAGTATCTCAATCAATAAAGTACAACCAAAATATCAAGTACGC
AGTCTCTGCTTCATCCCAGTGTAGATTTGCTATTCGATTTGTGTCATAAACATTTAACAT
TGCGCCCGTCTACAACAAAGGAGATAAATCAAAAAAGGAA
Chr coordinates Chr IV from 1263324-1266158
w3c xhtml validator w3c css validator