Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KRE2
Systematic Name YDR483W
Alias MNT1
Strain S288c
Description Alpha1,2-mannosyltransferase of the Golgi involved in protein mannosylation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KRE2 YDR483W
ATCTCTTCGAGATCCGTCTCTTTTTAGGACGAGAGCTCGAGTCAGATCCAGGAACAAGAC
GTGTCTGTTCGCTTGGTAATGTGTGAGTCATCATGCTGCTAATGCGCGTTCAAATAATGT
CCCGTATGCTGATATGTAAATGTTTATGTAGCCACTTGCTGGCAAAATGTGGAGCACGAA
AAAATATAAACGTTTAGATACACTTCTTTCTTTATATACTAAAATCCCTTTACTTTTCCT
CTACGCGCGAAGCTTATCGCTATCGTCAATGCTGCTATTCATGTCGATGCTGCTCTTCCG
TTAGACGCGCCTTACGAGGGGTGTACAAAGAGGACATCCGCTGCTGTTCTTGCCACTCGT
TCGTCAGTTTTGCCCTCAACGCTTCACATTTCTTGTCAATCTGCTCTTCCGAGAGCGTTT
CTTCCTCCTCCAGTCGGTCCCGTAGCTCGCTAACTTGTACTTCAATCTCACGTTTCTCCA
TATGAGTCTCTATCTGTTTCTGCACAGCAAGAGGCCTGCTTGCCTTGTCATGGCTGGCCT
TTTTGATCGCATTTTGTCGTTGTTGCCGCTGCTGTTGACTACCCTGTGGTCTGCGCCTAT
TGTTGCTAGCAAGTGATCGCTGCACGTGGCCCGACGTAGATGACCCTTTTGCCGACTTGA
GCCCTATTCCGTTGTACGACATGACTGGACGGTGATGCAGTAGCTGTTAACCGTCGAATG
GTATTGTGTAGAGCTCAAATTAGGATTACACAGATTATAATACCACACTTATAGTGCCAT
TCTTGAGGTCTTACTTGATTCTTCCTTGCCTTTACCCGCACGCTTAATATAATTTTTCCT
TCTTATCTGCTACGCCTTCTTCTAGTAGGAAAAAAAAAAGAAATTTGGTGAAGAAACAGT
CTGAAAAGGAGATAATTTGCGATTTAATTCGTTTATACATTTTATGAATCTATAATACTG
GAAGTGATATCCATATTCGCAAGCAGTTCCACTCGAAAGC
Chr coordinates Chr IV from 1421157-1422485
w3c xhtml validator w3c css validator