Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIB3
Systematic Name YDR487C
Strain S288c
Description 3,4-dihydroxy-2-butanone-4-phosphate synthase (DHBP synthase), required for riboflavin biosynthesis from ribulose-5-phosphate, also has an unrelated function in mitochondrial respiration
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIB3 YDR487C
GGCGACCTTGACGGGCAAGATCATATTGTACGAGCTTAGATTGAAACAGAAAAAGCCAGA
AACACCGGTAGTGTATGTCGTGCAGCGAAATATGGTGGCAAGACACTACTTTCAGCACCC
AGTGGTGGCTGTAATTGAAACAAGCAGCGTGCAAGATCAAGAGAGAGTACTTGTGGCAGC
TGATAATGGCAATATTATGGAGTTGAGCTGCCTGGACTTGACTGTTTTGCGGAAGCCACA
GCAGCTCCGTCCTGTACCGCTATCACAGCTTTTATCTTTGGAGAATGATACTTGCACATA
TACGGAGCGATTGCAGCGGTTGGCAAAGTTTGATGAGGTAGGTATAGCTTGCATGGCGTA
CACGAGTGAGGACCCGCAGTACGTCTGGATCGGTGGCGAAGACGGTGGTATATACAAGGT
TTTCTGGGACCAACCTGGGCCGCTGTACCTCTCTTTGGACAACAATGGGTTCCAACCTGC
AGAAAACCACTCTACGAGGGTAACCGGGTTAGAGTTTCATTGGGACGATGCTCGGCGGCT
AATGCTTCTATTATCATGTTCCACGGACTGGACGGTGCGGCTGTGGGACGCGCGAGCAGG
GAAAGCTATCATAGGGGCGCCATTGTTGTTAGGGGGGCCCGTACTACGTGCACGCTGGCT
CGAAAAAAACAATGGAGGGGAAAATAGTCGCACTCTACGGTGTCAAGTGTGGTGTGCAGA
TGGTCGCCTCGTTGTTGTAAATTGGGCTTTCGATGCTAAGACGTCCCTCTACACGGCCAC
TGTTATCTCCTAACGCCGCTTCGAGGCGGGTGAGCATAGGTTATTGCCTGATGAGTAATT
TCTTAGCGAGAATTGATAAAAAAAAGCAAGGCTATTATTAATATACGTGCTATTGTGAAA
TTTTCATTGGCGTATATATGTGAGGTGAATGTAAATATCTCCAACAAAAAGCAGAAGGCT
AAAAAAAAGGAAAGGAAAAGAAGAAAAGGCAACGTCGAAA
Chr coordinates Chr IV from 1428980-1428354
w3c xhtml validator w3c css validator