Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VPS3
Systematic Name YDR495C
Alias PEP6, VPL3, VPT17
Strain S288c
Description Component of CORVET tethering complex; cytoplasmic protein required for the sorting and processing of soluble vacuolar proteins, acidification of the vacuolar lumen, and assembly of the vacuolar H+-ATPase
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>VPS3 YDR495C
ATGGTAAAAAAGAAAACGAATAATGACAAAGGAAAAGAAGTAAAGGAAAATGAAGGAAAG
CTCGATATAGATAGCGAATCCTCACCTCACGAAAGAGAAAATGACAAAAAAAAAACAGAA
GATGATAGTCTACGTGCAACAGAAAGTGAAGAGACGAATACACATAATGCTAACCCAAAT
GAAACAGTACGAGCTGATAAATTTTCCCAGGAAGAGAGTCGACCAATCGAAGACAGTCCA
CATACTGATAAAAACACAGCACAAGAAAGCTGTCAGCCTAGCAGCGCAGAAGATAATGTC
ATAAATACAGATATTACAAGCTTAAATGAAAAAACCTCCACGAATGATGAACAGGAAAAA
GGGTTGCCACTGAAAATAAGCGAAGGTCCTTTTACAATCTCTACCCTATTAGACAATGTA
CCATCTGACTTGATATACACATGTTGTGAGGCGTATGAGAACCACATATTCTTGGGAACA
ACTACAGGTGATCTTTTACATTACTTTGAACTTGAACGTGGAAACTATATGCTTGTGTCG
CAAACAAAGTTTGATGCAGAATCAAATTCGAAGATAGACAAAATCCTTCTTTTACCTAAA
GTAGAAGGCGCACTAATATTATGTGATAACGAACTAGTTTTATTTATTCTCCCAGAATTT
GCACCAAGGCCCAACACAACTAGACTTAAAGGTATTAGTGATGTCGTTATTTGTAATTTT
TCCCGAAGCTCGAAGGCTTATAGAATATATGCATTTCACGCAGAAGGCGTAAGACTACTC
AAAATATCTGCAGATTCATTAGTACTTACCAAAGCTTTTAATTTCAAACTAATAGATAAA
GCTTGTGCGCACGAAGAAACATTAATGGTTTCGAAGTTAAATAGTTACGAACTTATAAAT
CTAAAGTCGTCACAGGTAATTCCATTATTTCGAATAAGTGAGACTGACGAAGACTTAGAA
CCTATAATAACCAGTTTCAATGAACAGAGTGAATTTTTAGTTTGTTCTGGAGGAGGATCA
TACGATAGTGGGGCGATGGCCTTAGTGGTAAATCATCATGGCGACATAATAAAAGGAACT
ATAGTGCTAAAAAATTATCCAAGAAATGTAATTGTTGAGTTTCCCTACATAATCGCTGAG
TCTGCTTTCCAGTCGGTTGACATATATTCTGCCTTGCCGAGTGAAAAATCCCAGTTGTTG
CAAAGTATAACTACTTCTGGATCGGATTTAAAAATTTCAAAATCTGACAATGTATTCACT
AATACCAATAATTCTGAAGAATTCAAAGAAAAAATATTCAATAAGTTGAGACTTGAGCCT
CTGACACATAGTGATAATAAATTTAGAATTGAAAGAGAACGCGCCTTTGTTGAAGAGTCT
TATGAAGAAAAGACCTCTTTAATCGTTTATAATAATTTAGGGATTCATTTATTAGTTCCA
ACGCCGATGGTCTTACGTTTTACATCATGTGAAGAGTCCGAAATTGATAATATTGAAGAT
CAATTGAAAAAGCTTGCGAAGAAGGATTTAACAAAATTTGAGCACATTGAAGCGAAATAT
TTGATGTCTCTTTTATTGTTTCTAATGACCTTACATTACGATCACATAGAAGATGAGGTA
ATGAAAAAGTGGTGTGACTTTTCTGACAAAGTTGACATCAGAATATTATTTTATATGTTT
GGCTGGAAAGTCTATAGCGAGATCTGGTGCTTCCATGGGTTAATAAATATAGTTGAAAGG
TTGAAAAGCTTGAAGCTAACTAACAAATGCGAGAATATTCTAAAAATGCTTCTGATGATG
AAGAATGAACTAAAGAAAAAGAATAAAACTGGACTCTTAACGAATGACTTTGATGATATA
ATGAAAACTATTGATATAACTTTATTCAAATTAAGATTGGAAAAAAAGGAAACTATAACT
GTTGATATGTTTGAACGCGAAAGTTACGACGAAATTATCAGAGAGATTAATTTACATGAT
GATAAACTTCCTAGGATAGAGTTACTAATTGAGATATATAAAGAAAAAGGGGAATATCTT
AAAGCACTAAATCTTTTGAGGGAAGCTGGGGATTACATTTCACTAGTTTCATTCATTGAA
GAAAATCTCAAAAAACTTCCTGAGGATTATATCAAAGAAAGAATAGCCGATGATCTTCTC
CTCACTCTTAAACAAGGCGACGAAAATACTGAGGAATGCGCCATCAAAAAGGTTCTTAAA
ATATTGGACATGGCATGTATTAATAAAAACGACTTTTTAAACAAAATACCCGCAGAAGAA
ACATCCCTGAAGGTATCATTCATAGAACAACTCGGTGTCCAAAACAGCAACGATTCCAAA
TTTCTCTTTAACTATTATTTGGCGAAATTGCGAGAAATAATCAACCAAAGTAACATATGG
TCCATTCTTGGAGATTTTATCAAAGAGTACAAAGACGATTTCGCGTATGATAAGACAGAT
ATAACAAATTTTATTCATATCAAATTAAAGCATAGTCTTCAGTGCGAAAATTTTTCCAAA
TATTATGAAAAATGTGAAAACTTGAAATCGGAAAATGAAAAAGATGATGAGTTTATTAAT
TTCACCTTCGACGAAATTTCCAAGATCGATAAAGAACACATATTGACCTTGTTATTTTTC
CCCAATGAATTAACAAACTGGGTTTCTTCCGAAGAATTGCTGAAAATATATTTGTCATTT
AATGATTTCAGAAGTGTAGAAAAATACATAGGCAAGCAGAACTTGGTTGCGGTGATGAAA
CAATACTTGGACATATCTTCTTTGAATTACTCAGTTGAATTAGTGACTAATTTGCTACAG
AGAAATTTTGAACTTTTAGATGATACAGATATTCAATTAAAGATCCTCGAAACTATACCT
TCCGTATTTCCCGTACAAACAATATCCGAATTGCTTTTAAAGGTACTTATTAAGTATCAA
GAAAAGAAGGAGGAATCTAATTTGCGGAAATGTTTGTTGAAAAATCAAATATCCATTTCT
GACGAACTAAGCCGGAATTTTGATAGTCAAGGATAA
Promoter Sequence
Download FASTA
>VPS3 YDR495C
ACATTTGCAAGAATTCATAATTGATAAGTTTGGTAGAAGGCCTTGGTTATACATACTATT
AGGTTTGGACGGTAAGTATTTCTCACCTATCGTCAAGAATGAATTATTGAGATACATTGA
ACTGTCCAAAGCCACCTCTAAGAAGGATCCTTTACAAAGAAGGCACGAACTTTTGTCAAA
ATTCGCCCCCATGTTTTTAAGCACTATATCAAAAGATTATTCCAGTATATTGACAGAGAA
TCTAGGCTGTCAGTTCATTGCCGAAGTTCTAATAAACGATGAGTTGTACGCGCAGCTGAA
TGAAAAAGACCAAGAAAAGTATCAACAGGTCTTAAACAACATTTTAACTACTTTTAAGGG
TGACATAACCGAAGAAGAGCACCCAATACATAGAGCATTTTCTACTAGACTATTAAAGGC
ACTAATTCAAGGTGGTAAATGGAATAACAAAGAAAAAAAGGTCATACCATTAAAAAATGT
TCAAGGCTTAGGCGTTCCATTTGCTGAAAAGTTATACGATGAAATTATTGACTCCTCCAA
CTTGTTAGAATGGATTAATAACGCTGATAGTTCATTTACAATTGTTGCACTGTATGAAAC
GTTAAAAGATCAAAAAGAAGGGAAACCATTTTTGAAGGATTTGAGAGGAGTTCAGAGTAA
AATCACCACTGATGAAAGTAACAAAGGCTCTCAGCTTTTGGCTAAATTGTTAAAATAAAT
TTTCTACGATAAAGTCACAATATTTGGTATATAAGCATCTGTACAATAATAATAAAAAGC
TTGATCTCATTGAAAGTGCAGGTATATATAATTGTCTCCTAAAAACTCCTTACATCGCAT
AATATCTGTTGAAGATACCGTTCCGATGGGAAAAAAAGGCAAGTTTAACTGGAAATATTC
ATATGTACTTACTATTTTATAACGACATTAGTGAATCAGAACTATCATAACAGTCAAGGA
GACTACCTTTTTTTGGTTGCAACCATAATATTATAGAACC
Chr coordinates Chr IV from 1441150-1438115
w3c xhtml validator w3c css validator