Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SAM2
Systematic Name YDR502C
Alias ETH2
Strain S288c
Description S-adenosylmethionine synthetase; catalyzes transfer of the adenosyl group of ATP to the sulfur atom of methionine; comparative analysis suggests that a mitochondrially targeted form may result from translation starting at a non-canonical codon upstream of the annotated start codon
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SAM2 YDR502C
TTAAAGTTGATTATAGGAAACTTGAGGCCTGACTTTGTTGATAGATGTATACCTGACCTC
CAAAAGATGAGTGATTCAGATTCTTTGGTTTTTGGCTTGGACATTTGCAAGCAGACTAAC
AAATGGATTCTATACGAAGGCTTAAAAAGCACTCCAAGCGGACATTCAAGTTTCATAGTC
AGTACCATGGGCTTTACATATCTTTGGCAAAGGGTTTTCACCACACGCAATACAAGAAGT
TGCATTTGGTGCCCTTTATTAGCTCTAGTAGTAATGGTTTCAAGGGTTATCGATCACAGA
CATCATTGGTACGATGTTGTCTCTGGAGCTGTTCTAGCATTTTTAGTCATTTATTGTTGC
TGGAAATGGACATTTACAAACTTGGCGAAAAGAGACATACTTCCTTCACCGGTTAGTGTT
TAGTAACACTTACAGAGTCCTATCAGGAAAGAATAAAAGCCGATCAAGCTTCATTCTCAG
GTAACAACTGGAGCACTGGCGAGCTTTGCTCTATTATATAAGATAAAATATGCACTAAAA
GTTTGCATTTCTTTACATAACTAAAACTAAGACATTATGCATAGCTTACCTGATCAAAAA
GTATGTAAACTTGTTAACATCTTCACATGTGATTCATCTGGTCGTACTTTCTTGCGGTGC
AGTGTAATATTTCTACCCACGTGACTATAATTGAGCTTGAAAACTGTGGCGTTTTTCCAC
CGATGGGTCCACGCCAGATATTAACCGAAGCCAAAATACCGATGAAATTTCTGAGATAGC
TCTTGTAAACGACGTCAAATCTTCATATGCAAGGAGATCTTGATTTCTTTTTGGTAGTCA
TCTGTCGTCTTGAGGCGTATAAGAAGGAGGTTATATCTGTCCTTTCTACAAAGTATTTTC
GAGAATCTTGCTTCTGCCCCTTTTTTCTTTTTTTAAAAGGTTTAAAAAACATAACTGTCT
TCAATATATCCAGTATTTACGACAATATACAAACATAATC
Chr coordinates Chr IV from 1454464-1453310
w3c xhtml validator w3c css validator