Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SMT3
Systematic Name YDR510W
Strain S288c
Description Ubiquitin-like protein of the SUMO family, conjugated to lysine residues of target proteins; regulates chromatid cohesion, chromosome segregation, APC-mediated proteolysis, DNA replication and septin ring dynamics; phosphorylated at Ser2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SMT3 YDR510W
GCTTCCCTCATTATTCCGCCCATGGCGTCTATTACCAAGCGTCATAATGTGCAATATTTG
ATATTATATAAGCTACTTGAGAAAGCGATAGTTTTTTTTTCTTACACAAAAAAAAAAAAA
CATAAAGCACCTATAACTCTCAACTTTGAAGAAGCACGAAAGGAATATGTTTAAATCAAC
AGAAATGTGAAAAAAATCGGTTATATATACAGAATCCGATTCTTTCTAACATCAAAGAGG
TGGGGGAAGAAGGGACTCAAAAAAGAAACGACACTGCACAACCCGAGCCAAACTGACATA
CGAACACTAAAACCGATTTCCGAAAAAAACTTCAAATTTACATTTCATTGTCCGTCTGCC
ATCGCATCATCGCCTTCATCTCTAAGAGTTGCCGTGCCTTTCCATCCGCTTTCTTTTCAT
GCGGCGTTATTCTTTTTTCCTATTTTTGATGGTCCCTGTGCCGTTTCTTTTTCATGTTCA
CCGGTTTTTGGCGCCGCATACCGTACGGCGGGGCACTTTTGAAACGTTTTTGTGCATCCT
GATGCCGTTTTCAAGGATCGCAAGCACGTCGCATAATACGGTAATGCCGAATTAAGGCTA
CGTCGTCATAGTAGGTTAGTCATGCGCGTTGGAAAAAGAAATGACCAACGCGTTGATTAC
GTAGTCCCCAAGGAATAATGCTTTTGAAAGTGAAAAAAAAAAATAAAACTGAAAAAAGCC
ATGCTGTTTCCATCACGTGCATGTCACGTTTTTGCCGCCGAACTCTTTGATCATGTGATA
TGAATATGTTGGGTTACCCAGCTTTGCCAACACGCGCCGTCGGAAGGTGTTCAGGAAGCA
GGAAAAGAGCAAAACACCAACAATCAAACAAACGAACACATTCTACTCTTTTAGTTGATT
TTTCTTACCTTTTCCAAGCTCCCGTTTCTTGTTACCACCTGTAGCATATAGGACAGAAGG
ACCCAGTTCAGTTCTAGTTTTACAAATAAATACACGAGCG
Chr coordinates Chr IV from 1469400-1469705
w3c xhtml validator w3c css validator