Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name URC2
Systematic Name YDR520C
Alias RRT4
Strain S288c
Description Putative Zn(II)2Cys6 motif containing transcription factor; non-essential gene identified in a screen for mutants with increased levels of rDNA transcription; similar to S. kluyveri Urc2p involved in uracil catabolism
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>URC2 YDR520C
TCTGTGAACAGTTCTCTAGAGTTCATCGAGAATCAATTTTCAAGCTTGGAACTACCACTT
TTGGCAAAAGTTCAAGGAACGTTGGGGTTAATAGATAATAAAAATCTGAAAAAGCTAAAC
TTTTCGAATGCCACCGATATTCAAGGGGGTCTAATGATTGCTAACAATACAGAGCTTGCC
AAAATTGATTTCTTCCCCAAGTTGAGGCAAATTGGCGGTGCAATATATTTTGAAGGTAGC
TTTGATAAAATTGACCTCCCAGAGCTAAAGTTAGTAAAAGGTAGCGCTTATATCAAAAGT
TCATCTGAGGAATTAAACTGTGAAGAATTTACATCACCAAAAGCCGGTCGTTCGATCATA
AGAGGCGGTAAAATCGAATGCACATCTGGTATGAAAAGTAAAATGCTGAATGTTGATGAA
GAGGGGAATGTACTAGGAAAGCAGGAAACTGACAATGATAATGGAAAGAAAGAAAAAGGA
AAAAATGGTGCAAAAAGTCAAGGAAGTTCAAAGAAGATGGAAAACAGTGCTCCGAAGAAC
ATTTTTATTGATGCTTTCAAAATGTCAGTTTATGCAGTTTTCACGGTATTGTTCTCGATA
ATTTTTTAGGTTAGAAGATTAACTTAAATACTAGCCATTTTATTTAGTTCTTATGAGATA
TAAATTTGCAGTAGAGATGTAGTGTTCTGATTATCTTCACCTGGAGCATAGCGTAGCCCA
CTTAGCATCAGCTTTTTATGTTATTTCAGGCATTACCAAAACTGGTTAAACTATTGAAAC
TGTTACCCTCCTTTTAATTTTGACAGTTTTTGAATAATTATTATGGTAGATCATCTTAAC
AAAATGAGCTCATTAGGTAGATGATTTAATTGAAAAATAGTGTTTTGATACGGTTCTTCC
TTAGGGTTAAAACCACTCACATTTTGCTTACTCACCATTAAAACATCTTTCCCAGTTGTA
TTTTATATTTCTTTCGGTTTGCTGAACATCAGGGAAAAAA
Chr coordinates Chr IV from 1483403-1481085
w3c xhtml validator w3c css validator