Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPS2
Systematic Name YDR522C
Strain S288c
Description Protein expressed during sporulation, redundant with Sps22p for organization of the beta-glucan layer of the spore wall; S. pombe ortholog is a spore wall component
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPS2 YDR522C
AAGGATTTCGTAGCTGGTTGTCTTGTTAAAACACCTGCTGATCGGCCATCGGCATATAAC
TTGTTATCATTTGAATTTGTTAAGAATATCACCATAACGAACTTGAAAAGTGATGTTGAT
CTAATTAAACAGAAAAAGGTTCAGGAGAGATATACAAAAGTTCCCAAATACCCTCTTCAA
AATCGCTTGTATAAAAACAGCAACACAGTGAGGGGAAAGGAATTTTGGAATTTTGAATCG
ACAAGACTAAGCACAACACAAATTTCCAAAGAGGAATTATCTCCCATTACACAAGACTCT
CCAACATCATCTTTAAATATGGAAAGTCCTTATTTACTTCATGGGCAAACTGTAACGCCG
ATAACCAACCCAAGTTCTTCATCATTTAGAAAATGTACGCAACCAGTTTTCGAGCTTGAT
TCAGGAATGGATATAGATTCAGGCTGCCCAAATGCTCAAGCAGAGACCGAAATAGTTCCT
CTCTCTAATCATAATAAGAAGCATAAAAAGAACGATATTCAGGCGTTGAAGATAGAAAAG
TTTGACTACTTGAAAAACATTGTATCTCATATTCTCAACAGAATGTATGATCGTGCGCGC
GACGATGAAACAAGAAAATACGTAAATGAAATGTTAAAGCAATTCATTAAAACTGAGGCA
AACGTTCCTGGATTTAATGAGGTTTTTATAGAAGAGATCTCACTAAGAATTGAAGCAATA
AAGAAAGGATTCGTTTAAAAAAATAGATATATATATATAATGTGTGTATATGCATGAGTT
TTTGTTTTCCATTCTCTTTCATCTTCAATAAATGAAGGATGGATATATTGAATTATATAA
CAAACAGTAAAAAGTCATGTGTTTTTGATTATTTACCTGCTTATTTCTCCCTTTTTTTTT
CGATTCTTTTTTTCTGATCGAGCGTTTATGTCTTTACTGTCCCGTCATTGATGCGTCTCA
AAAAAAATATTTTGTGGCATTACTTAGACTATAAAAGAAA
Chr coordinates Chr IV from 1485303-1483795
w3c xhtml validator w3c css validator