Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name QCR7
Systematic Name YDR529C
Alias COR4, CRO1, UCR7
Strain S288c
Description Subunit 7 of the ubiquinol cytochrome-c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; oriented facing the mitochondrial matrix; N-terminus appears to play a role in complex assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>QCR7 YDR529C
AACTAGTGGTGACTGAAGATCTAAATGGTGACGGAGAATATAAGCTGCTACTCAACAAAT
TTCCTGTGGTCCCTGAACATAGTCTCCTAGTGACAAGCGAGTTTAAAGACCAGAGATCTG
CTTTGACGCCAAGTGACTTGATGACTGCTTATAATGTGCTCTGTTCTCTCCAAGGAGACA
AGGACGATGATGTCACTTGTGAAAGGTATCTGGTCTTTTATAATTGTGGACCTCATAGCG
GTTCCTCACAAGATCACAAACACTTGCAGATCATGCAAATGCCTGAAAAATTTATACCTT
TTCAGGACGTATTGTGCAACGGAAAGGATCATTTCTTGCCCACCTTCAACGCAGAGCCAT
TACAAGATGATAAGGTTTCCTTTGCTCATTTCGTCTTGCCGCTGCCGGAATCGTCTGATC
AAGTGGACGAAGATCTTCTTGCTATGTGTTACGTATCTTTGATGCAGAGAGCACTTACAT
TTTTCCAAGATTGGACCAATGAGTCTCCGGAGTTGACCAAGTCATACAATGTGCTACTGA
CCAAGAAATGGATCTGTGTAGTTCCAAGATCGCATGCCAAGAGTGGACCGCCATTGATGT
TAAACATTAACTCCACGGGGTACTGTGGTATGATCCTCGTTAAAGACAGAGAAAAACTAG
AGAACCTCACTGAAGATCCTCATCTTGTGGACAAGTCGTTACTGCAATGCGGTTTCCCCA
ACACAGCAGGCCAAAAACCAACAGAGTATCACTATTAAGGTCTATTAGCCATATGTACAT
TGTCTATAGATGTGTAACTGCGCTGTGATCTTGTTTTGACCAATCAGGAGCGACGCGCTT
TTTATCGGGTCACCCCGGCGGGGGGCCTGACAATTTACTTTCATAGAGCAGTAATAAAAG
GGAAGAGATGTAAAAGCTTGGAAAAATAGCAGTAAAGGTTGTTGTTGGACAATTTATCAG
AATATTAGTAACTGTAATTAAACGTTCCAGAAAGAACAAA
Chr coordinates Chr IV from 1496548-1496165
w3c xhtml validator w3c css validator