Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CAB1
Systematic Name YDR531W
Strain S288c
Description Pantothenate kinase (ATP:D-pantothenate 4'-phosphotransferase, EC 2.7.1.33); catalyzes the first committed step in the universal biosynthetic pathway for synthesis of coenzyme A (CoA); transcriptionally regulated by Upc2p via a sterol response element
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CAB1 YDR531W
GCACAATACGTCCTGAAAAGGTATAAATTTTTCAGGCATTTGCATGATCTGCAAGTGTTT
GTGATCTTGTGAGGAACCGCTATGAGGTCCACAATTATAAAAGACCAGATACCTTTCACA
AGTGACATCATCGTCCTTGTCTCCTTGGAGAGAACAGAGCACATTATAAGCAGTCATCAA
GTCACTTGGCGTCAAAGCAGATCTCTGGTCTTTAAACTCGCTTGTCACTAGGAGACTATG
TTCAGGGACCACAGGAAATTTGTTGAGTAGCAGCTTATATTCTCCGTCACCATTTAGATC
TTCAGTCACCACTAGTTCTTCGTCGGGATTGGCGAACGGGTCCTCCGCCTTTGAATCGCT
ATTCTTGTTAGCGTCTGGCTTAAGTGCCAAAGATGGAGCAAATGTCACCCAATATTGTGT
CGTCGTTTGAGGATCTTTCAACTTCTTGGATTCTGCATGCGTTACTTTCAGATGCCCATT
CTTTTTGGCTGCAACGAACTTATCGTGGATTTTCTGTTTCAAATTCTCTTCAATCATCTT
TGTCTTCCTATTTTCTCTGACCCAGGGGCTCGGTTGCCTTTTAATTTTATTATATTTCAA
TAGTTCAACACATTTTCGAAACAGGCAAAAGCTTTACACGTGACGTTGGTATGATCGAGT
ATTATTCATATGGTCGTTCATGATTGCGTATTTACGACAGTATCTCAAAAAGTTTCACTC
AAATGCGGAGAACTATCCGCGATCTACGCATTGAGCTCCTTTAGTTTGTAATTGCCGGGA
CCGATTTTTTTTTTTTTACTTCTGACTGTTCCACTTAGGAATCTTACATGACGTTAAACG
ACTAGCGCAGTTCCCCCAATATCGGCCGAAATTTTATTTCACCAACATAACGATGAGTAA
AAAGAACTTATGTTTCTGAACAGATTGATCATTAAAACTAAAAAACTACCAGAATAAAGA
AATTTATAGTTCCAATTGAGTGCATGCGAAAAGAATCGCA
Chr coordinates Chr IV from 1498232-1499335
w3c xhtml validator w3c css validator