Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP31
Systematic Name YDR533C
Strain S288c
Description Possible chaperone and cysteine protease with similarity to E. coli Hsp31; member of the DJ-1/ThiJ/PfpI superfamily, which includes human DJ-1 involved in Parkinson's disease; exists as a dimer and contains a putative metal-binding site
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP31 YDR533C
ATGTACCAGTATGTAATATTATATCAAGAAAATATCAGGTGTTGATTAAAATAATCTAAA
AACAATGTCTATTTCACTTGTTAAATATGACTTTTCAAAAATAACCATTTTATTTATTTC
TTGCTTTTTAAAAGGTGAGAGTGGGTATTTGTTTTATCTGACGCCAAGGAAAATAAAAGT
TAAAAAATGACATGATGATTTTATAGTTCAAAACAAGAAATGAACTTTCGTGTTTGTGAT
CAGATTCAAATGGAGTATAATACTGAAAGAAGGTCGAGAAAGACAAGCAAGCAAATTCAC
AACTTCATTGAGCGCATTTTATTGAAATTACCTGTAGCAATGAGTAGTTCAGTTTGTCAT
ATAATTATGTTTTTGTGAGAAATTTTAGCTTTTGGTACTGTGCCAGTTATCCGAATTTAA
AAAAAAAAGTTATATATGGCTGTAATAATTTAGGTCAGAGAGAAGAAAACACGAAGTTTA
CTACGTGTATTAAAAATAGAACATTAAACATGCACCAAATGCTTTAATGAACACTTTCGG
AAGAATAAGCCCATAAAAAAATCACGACGTACCGTTGCGACAGATAGGATCGTTCTTTCT
AGGAGATTTTTTAGCTGCTACGGAATAAAAGAAATAATGCTGACTAATACGCAGGATATC
CATGGGAGGCGGCTTTTTGTTCTGACGGATCCATAAATCCCGTAAAGAAATCTGGGCGAA
TGTATACAGAGAATTAACGTTACTCATTCCTAGCCTGAAAATCAAAAAGCTTGGCATAAG
GGGCATGTACATAGTCTTCATGAAAGAAATGGAAAATTTTTTCAAGGGATGGCTTCACGG
TTCCATTATTGCTTCCGGTTTCCGTTACCCTTTAAATCAGATATATAAACAGCCATAAGG
AGAACCATTCATTTCTTTATCATCCGCTAAATTTTATTAACGGCATTTTTAAGTACTTCC
CACTGGCTAATTACACAGATAAAACTCAAACAAATTTATA
Chr coordinates Chr IV from 1502160-1501447
w3c xhtml validator w3c css validator