Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YDR544C
Strain S288c
Description Dubious open reading frame; unlikely to encode a functional protein, based on available experimental and comparative sequence data
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR544C	6320753 upstream sequence, from -1000 to -1, size 1000
TTCCTATCCATTGCACCAGTTCTGAATTTTACCACTTTGATTAGGCCAGACTTTTCGTCT
TCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGGACAATGT
ACCAAGTCGTTTTTGTTATTTAGAGCCGACTCAAACTCGTCAAAGTTTGCTTTTTCAAAC
TTACGCCTATCGGAAACTTTCATTTTATTTTTGTAAGTTTCGAAATTAACAATAGTATGT
TGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCC
GTCTTATCATCATCTAAGAATGTAATAATTAAGCTACTCTATTGAGAAGAAGCAGAATCT
GCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTC
ACTAAGATAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCGCT
TGATTTCCGGCCTGCAAAAATAAAGTAGTCGGTACGTACTTTCGTTTTCAATTTCCATGG
TGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAG
CCGCTTCGTGGATATTCTCTTGGATACTTTAAATATGGACCTACGCTTAGCCTGCGCTTA
GCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTT
CCTTATTAGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACA
TATGGCGCGTCAGACAGACAAACTTCCCCCAAAAATGTATTACCCCGCCGAATAAGAAAA
CAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAA
AAATTCCTTGACGCTAGATCGTTGGACTAAAATCTGCGTCACAATCGCCTAAACAGGAAA
TATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTAT
Chr coordinates Chr IV from 1525523-1525095
w3c xhtml validator w3c css validator