Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name URA3
Systematic Name YEL021W
Strain S288c
Description Orotidine-5'-phosphate (OMP) decarboxylase, catalyzes the sixth enzymatic step in the de novo biosynthesis of pyrimidines, converting OMP into uridine monophosphate (UMP); converts 5-FOA into 5-fluorouracil, a toxic compound
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>URA3 YEL021W
TCATAAAATTGATAAGGAGAATCCATACAAGAAATCGATCGAATTATCATTGAAATCCAT
TCAACTAACATCACACTTGCTGGAAGATAATAACGATCTGCGTAAAAACGAGATATTCGC
TATTATTCAAGCTTTGGCACATCAATGCATCAATCCGTGTAAGCAGATAAGTGAATTTGC
AGTGGTAACGCTAGAGCAGACGCTCATCAATAAAATCGAAATTCCAACTAATGAGATGGA
ATCGGTAGAAGAATTAATTGAGGGCGGATTACTACCGTTGCTAAATTCGAGTGAAACACA
GGAAGACCAGAAAATCCTCATTTCATCCATATTAACAATAATTTCAAATGTTTATTTGCA
TTATTTGAAACTAGGGAAGACAAGCAACGAAACGTTTTTGAAAATTTTGAGTATTTTCAA
TAAATTTGTAGAGGACTCAGATATTGAAAAAAAGCTACAGCAATTAATACTTGATAAGAA
GAGTATTGAGAAGGGCAACGGTTCATCATCTCATGGATCTGCACATGAACAAACACCAGA
GTCAAACGACGTTGAAATTGAGGCTACTGCGCCAATTGATGACAATACAGACGATGATAA
CAAACCGAAGTTATCTGATGTAGAAAAGGATTAAAGATGCTAAGAGATAGTGATGATATT
TCATAAATAATGTAATTCTATATATGTTAATTACCTTTTTTGCGAGGCATATTTATGGTG
AAGGATAAGTTTTGACCATCAAAGAAGGTTAATGTGGCTGTGGTTTCAGGGTCCATAAAG
CTTTTCAATTCATCTTTTTTTTTTTTGTTCTTTTTTTTGATTCCGGTTTCTTTGAAATTT
TTTTGATTCGGTAATCTCCGAGCAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATT
GGTATATATACGCATATGTGGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCA
ACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATC
Chr coordinates Chr V from 116167-116970
w3c xhtml validator w3c css validator