Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNU13
Systematic Name YEL026W
Strain S288c
Description RNA binding protein, part of U3 snoRNP involved in rRNA processing, part of U4/U6-U5 tri-snRNP involved in mRNA splicing, similar to human 15.5K protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNU13 YEL026W
ATGGCTGGTATCATTGCCATTTACGGTTTAGTTGTTTCCGTTTTGGTTTGTTATTCGTTG
GGTCAAAAGCAAGCTTTGTACACCGGTTTCATCCAATTGGGTGCCGGTCTATCAGTCGGT
TTGAGTGGTCTAGCTGCTGGTTTCGCTATTGGTATTGTCGGTGATGCAGGTGTTAGAGGT
TCCTCTCAACAACCAAGATTATTCGTCGGTATGATTTTGATTTTGATTTTTGCTGAAGTT
TTGGGTCTATACGGTTTGATTGTTGCTTTGTTGTTGAACTCCAGGGCTACTCAAGATGTT
GTCTGTTAAGGCAGCTTCTGAATCACTAAAGCAGGAATAGAGTATACAAAAGAATCTTTT
TGTGAGAAACTATGAAAACTATCAAAATTTTTCATCTTAGAGATTGTTTATAGCCCCTAT
TCTTACTTCATATCCAAACTACCTCATTTCAAGCTTCCTTTTTATTAGTACCATTATTAT
TGTTTAAAAGAGTATTACACGCTAAATATGTATATCTTAATTTTTAATGTGTATAAAATA
GAAAATTTGAATATCAAGGAGCAACAAAGAGCATTATGCGTTTTAAGCTACACAATGGGT
ACGATGAGATCACTATACCTGTACTCTTAAAAGAGGCCCAACCTTATCAACTTCTATTGT
TAAAGTAGACAATTGTATCGTTTCTTTTTCTTATCGGTTTTATCCGGGTAATAAATTCAG
CATATAGAAAAATTTTTCATTTCTATTTTCTTTTTCTTTTCATTTTTCCTTTTTCTCAGA
AAATTTTTTTTTCTAATGCTGGAATGAGATGAGTTAGAAAATTTTTCACTTTAAAACTGA
TTATTCTGGTTAATAGTGCTTATTCCTCTTAGTGTTCAAGTCCTACTTTCAAATCTTAAT
TTAAATCATCATTCGAGCGAGCTTTCTATACCAGGACCATACTGATTATTGCAAGGAACT
TGAATAAACCAGATTTCATACTATAAAAACTATATTAAAA
Chr coordinates Chr V from 101943-102323
w3c xhtml validator w3c css validator