Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RAD23
Systematic Name YEL037C
Strain S288c
Description Protein with ubiquitin-like N terminus, subunit of Nuclear Excision Repair Factor 2 (NEF2) with Rad4p that binds damaged DNA; enhances protein deglycosylation activity of Png1p; also involved, with Rad4p, in ubiquitylated protein turnover
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RAD23 YEL037C
CACACTTTCCTGCATTCTCCTTTGAAAAGCACGCAGAGACAGAAGCATTCGGTAGGCTCT
CCCGCAGGATGAATTACAATGTCATCGGCTTGCCCCATTATGTCATCTGGCACATCTACG
AACCTTCCAGCGACGACTTAAAGCACATGGCTTGGATGGCTGAAGAGGAGAAGCGGAAAC
TAGAAGAAGAGAGAATTCGCGAATTTTACAACAAGATCTGGGAGATTGGATTTGAAGATG
TCAGAGACCAATGGAACGAAGAAAGAGATTCAATCTTAAAAAACATTGACTCCACTTTGA
ACAATAAAGTCACTGTAGACTGGTCTGAAGAGGGAGATGGCTCGGAGCTGGTGGACTCAA
AGGGTGACTTTGTCTCACCAAACAACCAACAACAACAACAACAGCAACAACAACAACAAC
AGCAGCAGCAGCAACAGCAACAGCAACAACAGCTCGACGGCAACCCGCAGGGGAAACCTC
TTGATGACAACGACAAGAACAAGAAAAAACATCCTAAAGAAGTTCCATTAGACTTCGACC
CTGATAGAAACTAGGCTCGGTTTTTTAGTGACCTACATATGAAGTACGAATTCATATAGT
TGTACATATATACCGATAATAATATCAAACCTCTATTCTTTGGTCTTTAACTTTTCTTTG
AGTGAATTACAATACCATTGTTATATCAATCACTATACACGGCTCGGTGGCGAAATTGAA
ATTTTTTTATTTTCTTCTCTTTCATTATGGCTAGGCAAGAAATAGCGACAGCAAAACTTA
AGAAAAAATGATAGAACAAGGTCCCATCCAGTATTGACTAGTAGCTAAAGCTAGAAGGTA
CACTTAGGTTTTTCTCCCTGTTTTTAAGTTTGAACCATTGATAAGGCCGTTCGCAGACAA
GCTTGCTACCATCCAATTTTCCTTCCTCTAAAGACTTAATAAAGGCATCTAACTCCACCT
TTAAATCACAGATCACACAAAGACAACATACAATAGAAAA
Chr coordinates Chr V from 82603-81407
w3c xhtml validator w3c css validator