Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CYC7
Systematic Name YEL039C
Strain S288c
Description Cytochrome c isoform 2, expressed under hypoxic conditions; electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone-cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CYC7 YEL039C
CCGCAAGATGTTGGCGTAAGACTGTGTTTCGGTTTTCTTTCCAGAAGTGTTGATGTCGAA
ATAACCATCTATATAAGAATTCAAATCCAACGAATCATGCGCAGGCGCGTTGGGATCCTG
AACATACCCGAACAGCAATTTCTGTGCCTTTACAGATCCACTAGAGTAGATAAACACACG
CTTCTTCCTCTTGATAAAGTCAATAGCATCTGCATAAACGGGCGCCTTAATCTGCCCAGA
TTCGTATCCGTGAGCCCAGACGTAGCCTTGCAACTGTTTCAAGATTGGATCCTTCACATC
CTTGGCCACCAACTCCAAAATATGCGCCTGCAACTGCTCCTTATTGTCGATGTGAAACTG
CGACAGAATGTTGGAAACCGGGGAGTCCCTTGTATCCTGTTGAACCAATTGCGGCACTTT
ATTCGTGAAATAAGGGAATAAAGTCTCCTTCACGAACGAGATCGGGCACACTGTCCCTTC
AATATCAAGCAAGTAAGTCGAGTAATTGTCTCCCATTTTTGGTATACGAGCTAGCAGGAC
CTTTTGCCCAATGACCATTCCATATTCATCCCACTCACCACCGTCATCGTTGGTATTATT
ATTATCATTCCGCTTGAAGAAAAAGAAACGAAAAAAGAAATGGATCAGCAGCCGGGTTAT
AGCGCCCCTTATTGAATTATTTTCCTTCGTGCCTTCTCTGAGAAGGGTCTGCAGTCCCCC
GCCGAGGGGTCTTTTCCCACCTTCTCAAAGCTAATAGCGATAATAGCGAGGGCATTTATT
CAAGTTCCAACTACTATAAGTGGCCGCAAGGGGCAAAGACAAAGGCACACAACATATATA
TATATCGTGTTGTGAAGCTCGAGAAGATTAGATCAGAATAGTTCTCTTTTTGTTGAGGTT
GAAACAAAATCAAAGACTTATACAAGAAGATCACATACAAGCATTTATTCACATTACTTT
AAGTAAACTTCAGTAAACTACATTACATCATAAACAAAAC
Chr coordinates Chr V from 79977-79636
w3c xhtml validator w3c css validator