Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YEF1
Systematic Name YEL041W
Strain S288c
Description ATP-NADH kinase; phosphorylates both NAD and NADH; homooctameric structure consisting of 60-kDa subunits; sequence similarity to Utr1p and Pos5p; overexpression complements certain pos5 phenotypes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YEF1 YEL041W
TCTTTAGTTCGTACATTCAAAGAATCGAACGATATCTATATTTTCTCTTATTTCTACGAC
AGAACCCGTCCATTGGGTATGCCCTTGTCCTTTACTTTGAATGAATTGAACGATTTGGCA
AGAATAGTGTGTAAAGGCGAAGAAACTTGGAATAGTGTCTTCAGTGGCATTGCGGGGTCC
CTAGATGAATTGGAAAGTGACTCGCACTTCTGTTTGGACTTATCTTTTCAAGTGTCCTTA
TTACATACGGGATATGACATTCCATTACAAAGAGAATTGAGAACTGGAAAGAAAATTGCC
AATAAAGAAATCGGTTGGTGTTTAGGTGCGTCATTACCATTGTTGAAAGCTGATAACTGG
AAATGTAAAATTCAATCAGCTTGAATAAGAACATGGACACCGCTTTTCGTCCCATGTATA
TTAAGGAAGAGGAGATTGCGGTGATATGTATTCTGTTATATGTCCTATTCTATAACCCTT
GAACAATATGTAAACGATTTTTACGTTATGAAAATCACTATTATCCCCACAATAGTTTAT
TATAACACCGCCGCCAAGACAGGGGATTGAAAAGGCCTTCCGAGGTTTATCCATTTTTGG
TAAAAGCCCGCCACGCCTTCAGGTGTTTGAGTATGAACTGGAAGAGTTATCTGTTAGGAC
CTCATAATCTTGAACATATGAGATAATTTAATATACTTTTGTTATGGATTGTTCCGTTGT
TTTAAGACTATATGGCTTTGTTTTAGTTTTAGGGTGATTGTGGATATCACACCGGTCCTC
AAGAAAATCGAAAACAAAAGGATAATCGGACTTATCTGGTGATCGAAGAAACTGCATTTC
AGGTCGTTTAATAAACTGCTAGCTATTGATATTATATATATAAATAAACCTACAATCAGG
TTAGTGTATTCATCTCACTTCTATAGCGTTGTGAAAGGGAAATGGAAATAGTGCAATCTC
AATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT
Chr coordinates Chr V from 75944-77431
w3c xhtml validator w3c css validator