Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GLY1
Systematic Name YEL046C
Strain S288c
Description Threonine aldolase, catalyzes the cleavage of L-allo-threonine and L-threonine to glycine; involved in glycine biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLY1 YEL046C
GCTACTATTGCTGCTATTGCCCCTACTACCGCTCATTGTTTCGACTTTCTCACGCTGATG
ATGATGACAATTTTAACCTTCCCCTAGGTCACAACTTTTTTTCCCTCGTTCGCTTCTTTA
CACTTCCATTCCTCACCGTCTCAGCGCGGAAGAAAAAAAGCACGCTAAGTAAACCCAAAG
TAAGCTAAGCTTAACTAAGCCGAACCTGGCCTAGAATTCTCTCTAACTCATTCTTTCTTT
CATCTACTCACTCGCCGAAGAACAGGCACAGACTAATAAACTATGCAACCAGAAGGTAGT
CGTCGTCATCGATATTCATCGAATATGTGCGGCGACAGGGCCTTCCTTCGCACAGAGAGC
CACACGGCACGCCGGGGTAGCTGTTTCCTATTTTTTTTACACACGGCCCCAAATTGTTAT
TACTATTCTTTTTTTCTTCAACGCAACCAATACTTCTTGTTGTATATGTGCTGACAAATC
ATGCCAGCGGCAGGCCTGTGCAGCACGTGACCCACGCTTGGCCCGCTATGAAATGTCACG
CGAAACGGACCCTTGCCTTTTTGGCGACGGCACTTCCCCTATCTGGAAAAAGCCGAGCAT
GCACCCGTACCCCACAAAGCTTCGCTTCCGGTTTCCGGGCAGCAGCGCCGTTTCTTTTTT
CCCGCTGCTTCGCCCTTTGTATTACTCATTGCGCACTTTTTCACTTGCCATATTCGTTCA
CCGGTTTTTCTTTTTATTTCTTCGTCTTTTTTCGTCTTTTTCTTCACTGGATATACGCTT
TTTGCATTTGCAATAGCACATATGTGTATATATATAAGCAAGTGTTGAGCTTGCCTGTCA
AATCCTCCATGTGTCCTTCTCGTCTATCTTGTTCTGTCTGGTATAGAGTAATACTTACAT
ACATATACGTACATTGTTTCCGCTGGCTAGTTCGTAACCACCTCCTTTCCTAGGCTTACA
CTCACTTTTACTCCCGCACACAAACGCAAACATAAACACA
Chr coordinates Chr V from 68792-67629
w3c xhtml validator w3c css validator