Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRD1
Systematic Name YEL047C
Alias FRDS1
Strain S288c
Description Soluble fumarate reductase, required with isoenzyme Osm1p for anaerobic growth; may interact with ribosomes, based on co-purification experiments; authentic, non-tagged protein is detected in purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRD1 YEL047C
CACCAGAGATACTTTGGAAAAAGTCAAATTGGCCATCTCCGAGGCCTTCGACTATGCTAA
AGAACATCCTTTCGACTGTAACGGACCTACCCAGATTTACCGTAGTGAATCCACCGAGGT
CGACGTTGATGGCAACGCTATCCGCGAAATAAAAACCTACAAATACTGATGCGTTCCAGT
TGCATCATGTGTATTGTTAGGGTTTTTGTTTTAGGATTGCTACCCTCTTCCTTTTTTTCA
TACATTACAATAATTTCGTGGCATTGTAGATTTAACGGCTTTCTTTTGCATCAATGATTT
TTATATTCAAATGGGTTTTTTCTTTTTTCTGTTTTGTTATTCAAGGATATTTCAACTCTC
ACACCATAATTATAACTAATTATGTCGGCACATTTGAGAACCAATGGTTAGTTTCCAGCG
CACCTAGCGACTAACTACCCTATTATGGAGGGACGAAGGTGGTCTTTCTGAGGGAAGGAG
GAAAAAAAGGTAAGAACCTCTTTTCTTTGTTCCCCATTGAGAGATCGACTGAATATGTTT
GGTTTTTTTGGTACTTGATTAAAGTTTACAACGGTACGTATCCACGTGGAGAAGCACATT
TCTTTGTATTCTACGATACTACGTATTAAGATTGAATGTACCCATGTATATTCTCGCAGG
GTTTCTTCACAGGATTTCGACGTACACCTTTTATACAAATATATATATATATTTATATGT
ATGCGTAAGAGTCTAAAAAACGTTCACTTTAATTCCTTTTTTGCTTTTACTACTATTGTC
TTTCTTCTTTCATTTGTCATCATGCAGTGAATGACTGAAACAATAGAGACAGGTATGAAA
AAGAAAATTTTTTTCTTTTCAAACGGTAACGGGGGCAACGCGTCGCGTTCCTGAACAGCT
TAATCTATTGCACGTATAAAAGCTGAGAACAATACGCTGACATAGCACCCCATTTTTTTT
TCTTATCTTCACTTCAACAACCCCTCATCCGTAATTGTAA
Chr coordinates Chr V from 66797-65385
w3c xhtml validator w3c css validator