Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VMA8
Systematic Name YEL051W
Strain S288c
Description Subunit D of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; plays a role in the coupling of proton transport and ATP hydrolysis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VMA8 YEL051W
TTCTTGAATTCGCCAACAGATTACCGTAAGATTCCAAGACCTGTGTCCTCAGTTTACTAT
TTCCCATCCGATACGAGCATAAAATACGCATCAAAGGAATGTAAAACCCGTCGAGAAACT
CATATTAAGGAATGGTATAACTATTTCGCACAGGCTTCCCACACCGATGATTCCACTGAT
TCACACACGGTGCATAAGACATTTTATGATTATCCATTAACTATTTGGGGGAGAGAGTTC
AAAGTCCCTAAGTGTACCCCACCTCGAGTCGCGCAGTTTACTTTCAAGCAGTTGTGTGGT
GAGCCTTTGGCCGCAGGAGATTACTTGACGTTGGCAAAAAATTTTGAAGCCTTTATAGTG
ACCGATATTCCATATTTGTCCATTTACGTTCGTGATGAAGTGAGAAGATTTATTACATTT
TTAGATGCTGTATATGACAGTGGCGGGAAACTGGCCACTACGGGTGCAGCGGATTTTTCT
TCCTTGTTTGTGGAACCTGAACAGATACTTAATGATTTTGAGTTACGCCCAACAACCAAA
GAACCTGATAGCGTCGATACTGGTATGGTAGATGAGATGGTTGAGAAACACGGTTTTTCG
AAAGAGATTGCCAAGAAATCGCAGATGTTTGCTCTTGATGAAGAAAGATTTGCCTTTGCC
CGTGCCTTAAGCAGGCTGTCACAGATGAGCTCCACCGATTGGGTTACTAAGCCTACATAC
TAAACCCTATGTAACAAAAGTGTTTATTTATATTCTTGTATTTATTCTAAACACGAACTT
TGATCGTCTAACAATTGCCGCAGTTACACCTTTAACAATAGTGCTTTTTATTACTGATAT
TACTCACCTGATTTTTTGTTACCCGAATGCAAATTTGATTAGGAACGGGGATTGTTAAAA
GACAATGGCAGTACAGATAAAGGTTAGATGAAGCAGCAGTAGAATAAATCAGCATCTGTA
GTACATAGGTTCCTAACAGCATTGTGAAAAAGGTTCAAAA
Chr coordinates Chr V from 58378-59148
w3c xhtml validator w3c css validator