Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SOM1
Systematic Name YEL059C-A
Strain S288c
Description Subunit of the mitochondrial inner membrane peptidase, which is required for maturation of mitochondrial proteins of the intermembrane space; Som1p facilitates cleavage of a subset of substrates; contains twin cysteine-x9-cysteine motifs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOM1 YEL059C-A
AATCAATCTTTTCGTGTTCAATCAGCTTGGCCAACTCAACACGAAATTCTTCAAAATTAG
TGGCAAAAGAGGCCGCATTGGCCAACTGCATGGCATATGGCTCCCATGTGGCCAAAAGCA
TCGATCCGTCTGGTTCCACGATCTTGACCCCGTTGTCCTGGTATGGGTTGTGCGACGCCG
TGATCATCACCCCCACATACTGACCCTGAAGCTTCAGCGACCTGAGAACCGCCAGTATAC
CAGTACTGAACATCACCGTATCCAAATTCTTGGCCAGCGTTCTGAATCCGGCCGTACCGT
AACTGAACTGCACATTCTTTGTGCGGCACGTGTCATCGTAGAGTTTGCACAATTGCTCGT
AATCAACCTTCATCGTCTCTAAGCTTACTGCTGACCTTTGCCTTGGTCCTTGTACTTGTC
TCGATTGCTGAAACCATTAACGGTTTTTTGTTCTTACTTAATCTTTTTTTTCCCGACGAC
GCAAAATGTCAGAAAAGATATAAATAGAGCAACGTTTCCTGCTACATGAAACACGCTGGC
ATATAGAAGAACTTCAACGAGCGAGGCTCTCTGAACAATCTGCTAATCGTGCAAGTAAGG
GTTCTCGTGACAGTTCACCGTGTATAAACAGATAAACAGATAAACAGTCAGATATGCTTA
ATTTTTAACTGTAGGCTGTGCCGACATGCCATTTTATGCGGCTCACTTCTAACAAAAGTG
ACCATGACGCACAAGCAAGCAAACAGCCAAGTAAGGAAGCAGACAGCTTCACAGCACACA
CACACCGTTGTGTACGAAAATCCTCTGCAGAAGAGTGTATATGCCACTCATCCACACTTC
CGCAGCGCAGTACGTAATGCGGTATCGTGAAAGCGAAAAAAAAACTAACAGTAGATAAGA
CAGATAGACAGATAGAGATGGACGAGAAACAGGGGGGGAGAAAAGGGGAAAAGAGAAGGA
AAGAAAGACTCATCTATCGCAGATAAGACAATCAACCCTC
Chr coordinates Chr V from 42624-42400
w3c xhtml validator w3c css validator