Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HPA3
Systematic Name YEL066W
Strain S288c
Description D-Amino acid N-acetyltransferase, catalyzes N-acetylation of D-amino acids through ordered bi-bi mechanism in which acetyl-CoA is first substrate bound and CoA is last product liberated; similar to Hpa2p, acetylates histones weakly in vitro
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HPA3 YEL066W
TCTCGCTTGTCTAAGGATGGAGTTCCTAAATTCTTCACGATCGGGAACAGGTCCTTTGTC
CCAACTTGCCAGTTTATCGTCAACGAGTTTATCAATCTCGTCGTAGTGGATAGTAATCCA
TGGATGATCTTCATTACCGCAAGTAGTCCAATTCACTGGTGGTAGTTTTACGCTCCAAAA
TCTCTTATCATAATCCGCTATGCGGTAAAATGTCGATGTATTATGCGTAAAATTGTTATA
ATTGTCTGTTGTATCCGTACAGCATACCAATGCCAAGCCTTGAAAGGCGACGGCTAGTGC
CAAAATTTTCATCCTTTCAGTATACCTGATTTTGGCTTTATCCTTTCAATGTGCCTGATT
TTGGCTTTCTCGTATCTTTCGCCTGATAATATGAAAAAGTATATACTGTGAAAAAACAAC
CGTTGGAGAGCTACGACCGACTGAAAAGATAAAAATGCTTGAGTTTTTCAGGTTAGCATG
CCGTCTAGTAGAATTAAACCATTGTAGTTCTTCACTTTTGTATTAAACGTAGGATTGAGG
CGGTGGCTGCTTTTGGTTTACTATGCGTTGTAAGGGGATGGGGAAATGGAACGTCCAGAA
GAAAGTTATAGTTCCCGTTTGCATAACAGCAGAGACAAAAATGGTCGAGCACTTCCGTGT
TGACTGTATATCTGTGCATGGTTGACTAATTGTTGTTTGATGGCCTGAAGTTCTTGTCAC
ACTCTGCAAATTATCCCGACATTCAGACGTACACGTACAAAACACGAATGCTACTCTAGC
ATATCCAATCGATCGCACTGAAGCGATCAGCTGATGATCAGGCGGTACATTGCATACTCT
GCGTAAGGCCTTTTTCACCAATTGACCGCATCGTATATTTCCCAATCCGGTTATTAAATC
GTTATCAGGCGGAAACCTTCGCGAACAGTATACTGGAGAGTGTTGCGACAAGATATTTAA
AAGCGGAAAACGGGCATATAAAATAGATGAGTGCAGACTA
Chr coordinates Chr V from 26667-27206
w3c xhtml validator w3c css validator