Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSF1
Systematic Name YEL070W
Alias MAN1
Strain S288c
Description Deletion suppressor of mpt5 mutation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DSF1 YEL070W
AATGTGGATATCATGAAAAATTTCATCTCCAAAAAGCCAAAATTCTACTCATAATGACAG
TGGTGAGAATTAGCAAGGTAAAATATTGGCATTATGTGGCAGGAGAAGGGAAATACGAGA
GCGGAGATAAGTTGGATATTAATGAGCTTTAGATGTTGAAAAAAAAAGAAAGCGTTACAA
TGCTCAATAAAACAATGACTTCCCGGAAAAGATTTTTTGATTATTTTATTCCGAGAAAGG
CCGATGTATGCTGAACCAACGTGTTGCTTGCCAACTTCAGCATACTTTGTTTGCCACCCT
ACTAGGAAGTGACCCCGAGAACTTTATTTTCTGCACCCATGGGTGCCTAAAACTTATTTT
TCTGCAGGGCGTTTGAGAAATAAGGGATATGGCAAAAATCGAAACGTGGGGTAGTTTCGT
GCCTTCTTATGTGCCTATCTTGATTTTTGCCTTTGTGCCTTACTCTCCTTACCCCGCGAT
ACCCCACCGTATATTTACTCTCTCCTTGGCACGGACCTAAAAATAACTGTAGAATGAGCT
CAACAAACAGGTAACTTTACGTAAACTGTTCTTTTTATCTTTCAGCTCGCCATTTTCTGA
TGCAGTACATAGAACTGTGATACGTCATTATATAGACTTTTCGCACACACAACCAATTAA
GCTTGCGCATCAGTGGTGGATATATGGACGGATACCTCGTATATTCTGTTGTTGTCGTGG
GAGAGGGCATCGCAAAGTCTAGAAGTAATTAAATTACTTTCAGCGTTTCCAAATGAGTTC
GAGAACAATTATATTCTAGGGGGAAGGAGGTTACAGCGGTTGCAGACTCATAGTTCCAAA
TTCCATTTATTTTTTACATATAAATAGCCAACATTTATCATCCAATTGTTAAGATTTTCA
CTTTGTCTAGATCTTTCCCTAGATCTTCAATAAAAATAAATAAAAATAATCAAAGAAAAG
GAAAAAGAAAAAGTAACAATTTAAACAAAAAAAAAAAAAT
Chr coordinates Chr V from 19589-21097
w3c xhtml validator w3c css validator