Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RMD6
Systematic Name YEL072W
Strain S288c
Description Protein required for sporulation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RMD6 YEL072W
GAACTATTATTGGCCGAGGCGGCAGCTAGGTTAAAGAATCTAGCCGTCAATGCAACGAAG
GTTATCAAGTACATTCAGTTGGATACATTAAAAAAGTTGAATACAATATCAATTCTAGAA
GATTGTAGCAAGTTTGGTGAGATAGTTTACGCCTATAATATATAAGTGCTAACTCAATGT
TCAGTTAGTAGAATCACAGCCTGAATATTCTGTGCATCGTTTACTCAGGGACAGATGCGA
TCTCAATGCAGGGACGAAAAACAGTCTTATATGCGCACGCCAGCAAAATCTTTTTTTGCG
GCACCTAAGATCTCTCGCATGATAAAAGCATAATATCTTTGCCCCACAAAGTCAAGGCGT
ATTGGAAAAGCTACTTTAGTTAATAATGAAATGATCGCCCATCCGGGTAAAAATGGTTAC
AATTCCAGTGTTGATTATTGTTCGTTTTTCAGAGAGAATAATTTAGATGCTCCTATTGAA
GAATATCTTGTTAGCGCATAGGGCAATCATCTACGACTTTAACCGCAACTGCGTCTGTTA
CCGACATTGGAGGATTGTATGCTCAAATGACCCCTGTGGTGAAGATGAACACTTCTTGCA
CACTATGGTTGAATCTTGACGGTACCCTCACTCAGAGTTTTATAGTATCACACGACGCTA
CTCTCCCGCTTGTACATTCATTCTGGCTAGTTTATAATAACGTTAAGGAAATGACACCCA
TACCTCTCAGAAATCCAATTGGAAATAATATTTGTAAAAGCACGTGATATTGCCTTTTTC
TTTTATCTGGTTACCAATATGGGATCAATAACTTTACTTTTGAAGATCTTGTTTTTCCTT
CAGATAAGAAATCAAAAAAAGAATATATGCACAAAACAGTATGGATATAATACACCTTAC
TCTTGGTCGTGATTGAAAACGTAAGGTTCTACATAAATTATTGAGAAAGACTTATTTGAA
GATATCGAGAGTCTATCATGCCCTTTGCACAACAAAACTA
Chr coordinates Chr V from 13720-14415
w3c xhtml validator w3c css validator