Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YEL073C
Systematic Name YEL073C
Strain S288c
Description Putative protein of unknown function; located adjacent to ARS503 and the telomere on the left arm of chromosome V; regulated by inositol/choline
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YEL073C YEL073C
AATAAGCATTTTTTAGCCATATCAAAATTAAACTTGAAGAGATATTTGCTGTATACTTTA
TGTCACATTATTTGGTTTAGGAGTAGATATTTCTCGTACTTATAACTATTATTAATTTTT
TCCAGTGTATTGCATCGCGCCAGTTATAAACTATTAATGGAAAGGATGCATTAATTTAAG
TAGAGAATCTTGAATTATTTTCTTTTTAACTCTTCCTGCCGTAAATTTAAGGAATACACT
ACGAACAATATTTCTCTAATTTCCTTCCATATATAAATGAGAGGTTTTTGAAACAATTCT
CATGCTTTCTTATACAGTTAAAAAGATACTTATTGTTCAGACATGTTAATACATAAATGA
TATCAGTAGAGCTTTTAAAGTCATATTACTCAGTGGTATCTGAAAGAGGTACATGAAAGA
CAAGAAGGATCTTCTATAAAAAAATAATTTTGGTGTCTGGTTCTTACTAAGTTACACGGA
TGTATAGAATAGATAGATATATAATTCGAATGGTCAATCCAGTGTATATATTATGCATCC
TTCGATCAATATTGACACTGTATTATAAAATATAAATTGATTTTTCATTCTTCTAGCCTC
CATATGGCATTTTACATGACTGGGGTTTACAGTACGAAGGCAACAGGAGAATAAGAGAAA
AAAAACTCCATAATGAAGAGTCGGTGGCTTTGCTATCAAAAATTTTATGCAACATATTTA
CAACTTCCTGTAAATTTCGTGACAGTATAAATACTATCCTAACGGCTTCCAACCCAAGTC
ATTATTTTTCACGCCGCATATGATTATACCCCTCGAAATCAATAATCATCTTCCTCGCTA
CAGTAATATTAATGAACGACTTAAAATGCATAATCTCCTAAACGGTCGAGCATGTGAAAT
TTACAAGGGCTGATTTTTATTCCAAAGCGTATAAATGGTAGCGAGATGGTGCTTCTGTAA
AGTTATCTATTAACGAAATAACAGATCATCTACTAACACG
Chr coordinates Chr V from 7553-7230
w3c xhtml validator w3c css validator