Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIR1
Systematic Name YER011W
Alias SRP1
Strain S288c
Description Cell wall mannoprotein of the Srp1p/Tip1p family of serine-alanine-rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIR1 YER011W
TTTTACTCTTAATTCAAATAAGCACTGCTATTATTACTTTTGATCACGTCAAAAGATACA
AAAGACAATCTACAAGTTTATGGCCTTGCATTGTTTATAATTTATGTGCTATCTGAGCAT
ACCCGCCTTTTCTCTATTGTTATTCGAGAGAAGACTAAAAATATCTGCTGCAAGAACAAA
AATGGGAACTGCTTGTCTCTTAAAATTATCAATCCACAATGGAAATAGACTTTTTTTACA
CAGCAACGGTTTTTGAATGCTATGAAACGGTCATTATCAGCTAACACGCTCAACACTTTA
CTCCATCTTCTTAAAGGGTGTAAACAGAACGATAAATGATTTCCATAAATAGTAAGGCCC
AGCCGACAGCCTGCAGCGCAAAAGTGAACCGTTTCCATCTAACTTGGATAATCTGCATTG
TTCCCAACGAATGACAGAATCCATCGCCAGATCTAATAAGGTTCAATTTTCTCTATACGA
CGGCTATAAAAGGAAGTTTTCCGAGCGCGCTTCGAAGCAGAATAGGGAGGACCCCAGACC
CGTTTTAGTGCCTGTCCCTTTTTAGTACGTGTTTCCGTTTCCGTGCCTGGCTAGATCCAT
CTTTCTTCGCGCGTTTATTTTCAGCACCATGTTTTAGGTTTTTACAGCATCGTTTAAGGA
ACCCAACAATACAATAGCGGGAAGAATGCACTTTCTCGTTCCATAAAGGGTCTCTTTCAC
CTATACGGTTGGTACAGATTTCCAGTGTATGCCAGTCAGCCACGGCATTACGTCGTTTGC
TTCTATTTTCTTCGTTTTGAACTGCGTTTGTATGCAACTGTCCCTTGACAGAGAAAAAAG
TGAAGCAAAATGACAGACAAAGAAATCTTTTGTATAAAAGGTCGGTTGAATCTTGTTGTT
AGCTTGAAATCAGCTTGCTTTTCTCCTCTAAATTACATAAAAAACCAAGAAAATATCAGA
CTTTTTCATTCGCTTTCAACAAGTACTACAATAATTAAAA
Chr coordinates Chr V from 175248-176012
w3c xhtml validator w3c css validator