Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SBH2
Systematic Name YER019C-A
Alias SEB2
Strain S288c
Description Ssh1p-Sss1p-Sbh2p complex component, involved in protein translocation into the endoplasmic reticulum; homologous to Sbh1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SBH2 YER019C-A
CAGTTCTTTGTCGTTGCTGCCACTTGAAGCGTCCGACAATGATGGTTGTGCTGCAACGTT
ACTCGACCTGTCTCTCAGGGCAGAGTCGATATTGATCTGTTGCGATCCGCTTGTATTTGC
CGTAGCCGTGGGAGATATCGCGTTATTAATGCTCCCGTTTTGCTCCTTGCGGTCCTTAAC
ATTATGCGGAGACGGCTGCTGCTGCCTCTGTTGTTGCTTTTCTTGTTGATTTGCTGTGTT
GACTGTTCTCACAGTCTTCTGTGGCTCCTGCTTTGGTGGTACCTTCGCTTTGCCAACGTT
GTCACTACCAGCGCTGGCGGTCTGCGTGTCAGGAGTGCTGCCGTTCTTTTCTGAAGATGC
GCAGAGACCCATGATATTTGCTTGAAAATACGCGTGATTTGTGCTGTAACAATAAGGCTC
GCTGTGATAGCAATTGCTCACTTTTATACCTATCGATTGCTCTTTGGGTAGTGAGAACCA
AACCTACCTAAAGTTTTTCCACCCCTTCAGTCTAAGGCTGCACGCACGCGCCTATAAATC
CTGCTGCTTATTAACTTTTTTTTTCGGTGCAGTATGCAAGAGGATAAGAAGAATCATTTG
GGCGCAGCTGAGGGGGCTTGAACATGATGAAGTAAGGGAAGAAGAAATCGCGAACGAGGC
AGTAGTCATGTTTTGTGACTGAATTGGCGGACTTCATTTTACTCCAGACATTTACTTAAT
GTGGAGCACGCCGGGCGCAGGGATCGTAATATATGGTATATCTTTAGTAATTATAAGTTT
GATTCTGCCCCGGGTACCACGGGTTACCCGTTTCCTTAGCCTTTTGGATTTCGTCTTTTT
TTTTTTCCTCCATTTTCACTTTTTCATTCAGTTACTAACTGGCCAAAAGAGACATTTTAG
ATATAAGAGGTATGAGAGAGTAGATATATGTGCGTGTGAGAAAAGGTAAGGGGCGCAAAG
CATAAAACAGGTGGTATTATCGATCAACAGTATCATAAGA
Chr coordinates Chr V from 194539-194273
w3c xhtml validator w3c css validator