Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAT2
Systematic Name YER024W
Strain S288c
Description Carnitine acetyltransferase; has similarity to Yat1p, which is a carnitine acetyltransferase associated with the mitochondrial outer membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAT2 YER024W
AATTATCACATGTAACCATGATGAACCTAGTGCACAACAAGTTACCGATCTAGTTGAGAC
ATTCGACGAATCTCCTAACGGTATTAAAGTCGAAAGCACTTACGGTCACAACGTGAGCGC
TGTCGAAGAAGCTTCTGTAGTTCTTCTTGGTACCAAGCCATTTTTGGCCGAAGAAGTGTT
GAATGGTGTGAAGAGCGTCATTGGGGGAAAGCTACTTATTTCCCTGGCTGCTGGCTGGAC
AATTGACCAATTGAGTCAATACACTAGCACTGTTTGCCGTGTTATGACGAACACACCTGC
CAAGTACGGATATGGTTGTGCGGTGGTGTCCTACTCAGCTGATGTTTCCAAAGAGCAAAA
GCCACTGGTCAACGAATTGATTAGCCAAGTTGGTAAATACGTTGAGCTTCCAGAAAAGAA
CATGGATGCTGCTACGGCTTTAGTCGGTTCAGGCCCCGCTTTTGTTCTCTTGATGTTAGA
ATCCTTGATGGAGAGTGGGTTGAAATTGGGAATCCCATTACAAGAGAGTAAGGAGTGTGC
CATGAAAGTTCTAGAAGGAACAGTGAAGATGGTTGAGAAAAGCGGTGCTCATCCATCCGT
TTTAAAGCATCAAGTTTGCACACCAGGTGGTACAACTATTGCCGGGTTGTGCGTAATGGA
AGAAAAGGGCGTCAAGAGCGGTATTATCAATGGTGTTGAAGAGGCAGCCCGTGTTGCGTC
ACAATTAGGCCAAAAGAAGAAATAGATTGCTTTGCGTGAAATGTATGTATGTTCGCTTTG
TAGCCGTATATTATTTTTTTATTACTGACCTTGCATTTTTTCGTCATTTTCCCGTCGGTC
CGATAATGAATCATCACGATGAATGACTACCCCATAATAATGACACTAATTGGAGCGTAT
AAAAGAAAAAAATTATATAAATGTGTTTGTAATGAGTAAGAGCAATTGATTCATTTGAAA
TGAAAATCAAAAATCAAAATTAAAATAAAACTAAGCAACC
Chr coordinates Chr V from 202192-204963
w3c xhtml validator w3c css validator