Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CHO1
Systematic Name YER026C
Alias PSS1
Strain S288c
Description Phosphatidylserine synthase, functions in phospholipid biosynthesis; catalyzes the reaction CDP-diaclyglycerol + L-serine = CMP + L-1-phosphatidylserine, transcriptionally repressed by myo-inositol and choline
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CHO1 YER026C
TCAGCAGCATCTGGCTGAAAAAAAAGCGAATCATGTAGATGATAGCAAATTGAGTAAGAG
ACCTATGAGCGCTCGCTCGAGAATCGCATTGGAGATAGAAAAGGAACCAGATGACATGGG
CGATGGTTACACTCGTTTTCACGATGAGACCCCCGCTAAACCTAATTTAGAGTACACTCA
AGATATACCTGCTGTGTTCACCGACCCAAATGTAATGGAACAATATTATTTGACACTTGA
TCAGCAGCAAAATAATCACCAAAATATGGCCTGGTTGACTCCTCCACAACTGCCACCTCA
TTTAGAAAACGTCATTTTGAATAGTTACTCAAACGCGCAAACTGATAATACGTCTGGCGC
CCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAA
TACATTATGTGTCGCATCCATTGTTAGGTATAAACAAAAATACGTGACCCAAATACTGTA
TACACCATTGCAATAGATATGATTATAGAGCTTATAGCTACATCTTTTTAGATAAAAGCG
AAGATGTTTCTGCGATTTTTCCATTATAGCTCTCCATGATACTAAATATCAAGGTCTACA
TGTAAGTATTTGTATATATGGGTTGGAATGTATATACGTATATACGTACGTACGTACGTA
TATGCACATAATTGTTACGGGATGTATATATAAATTAGTAGCATTATAGAAGATATCCCT
AACATCAATCCCCACTCCTTCTCAATGTGTGCAGACTTCTGTGCCAGACACTGAATATAT
ATCAGTAATTGGTCAAAATCACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTT
TCACATGGACCCATCTAAAGATGAAGATCCGTATTTTATAGGAAACATTATAAATAAGGA
AAGAGAGATACACCTATTTTTTTCATTTTGTGGGTGATTGTCATTTTTAGTTGTCTATTT
GATTCAATCAAAAAACAAAAATAAAACTATATATTAAAAA
Chr coordinates Chr V from 208474-207644
w3c xhtml validator w3c css validator