Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SMB1
Systematic Name YER029C
Alias Sm B, SmB
Strain S288c
Description Core Sm protein Sm B; part of heteroheptameric complex (with Smd1p, Smd2p, Smd3p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm B and Sm B'
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SMB1 YER029C
AACGGGAATGCCAATGGTGCGTCCGCTCCTAATGGACCAACGATTAGTCTGACACCAACA
CCAAACGAAAACAAAAAGGCAAATGGAAATAACTGTTGTTAAGAGATATTTTGCAGCAGT
TGCGCACTTGCATGTGAATGACTCTTCTCCCCTTTAATTCTGTGCTATATTTTTACAATT
TTCTGCTGACATATAGTTTATATACATATAGAACGCATATAGGAAATTGAAGTAAACAGA
ATACACAAGTAGAGGCCGGTATGTACGACATTTTGCTTACTACTCTTTAAAATCATCGTC
TTCTTCGTCTTCATCGTCTTCTTCTTTTTCACCATATCCTACATCATCTTTAGAGCCTGT
GCTAGGTTCCTTCTTGTCTAATTCTTCTGCAGTCTTTTTATAGTCAATTACTTTGCCGCG
TGTTCTTCTTCCGGATGTGATGATATTAGAGGTATCAATTTCTGCCAAATCGTCCTCTTC
TTCTTCTCCCTCATTTCCCATCAATGCGTCTAACTTGGCATCGTCCATATCAGATTCAGA
ATCTTCAACAGTACCATTATTTTCGCTCTTCGTCAAACCATTTTTAGCCTTAGTCTCCTC
TTTTGCTACTTCAGCGTCATAATCGTCATAGTTTCTTCTTCTTCTTCTCTTTGGCTTAGG
TTCCACAGACTTTTCGGATTTATTATGACTTGATTCCTTTTGGCTTTCTAATTCACGCTT
TTCCTTTGCTTCGTCAGACATTATTTCTCTCTTTCCTTCCATGTATTGAATTTTACTTAC
CAGGTGTGTTCCCCAATTAACCACCCACCGAGCTTCCTTATTTCTCCATGTTCTTGTTTT
TCTCACGATAATGTGGGAAAAAATTCAAAATAAAAATTATGAAAATAAAAAATGAAATTT
AAAGAAGCCTATGCTAGTTAGAAATGAACAAGACAGGGAAAAAAGTAGAAGGGGTAACAG
AACCATCCGTATAACAGGTTTCCAGTAAAGTAAATAACTA
Chr coordinates Chr V from 213177-212587
w3c xhtml validator w3c css validator