Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KRE29
Systematic Name YER038C
Alias NSE6
Strain S288c
Description Subunit of the SMC5-SMC6 complex; this complex is involved in removal of X-shaped DNA structures that arise between sister chromatids during DNA replication and repair; heterozygous mutant shows haploinsufficiency in K1 killer toxin resistance
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KRE29 YER038C
GGACAGATGTAAAAAACTGGTTTCCAATTTCTTTGCTGCTCGTATTGATGATTTATACGT
CGTCAAAGAGCTTACAATACCTTGCCGTGCCCATCTACACAATTTTCAAGAATCTGACGA
TCATTCTCATTGCTTATGGCGAGGTCCTCTTCTTTGGCGGAAAAGTCACTTCTATGGAGT
TGACGTCATTTATTATGATGGTCCTTTCATCTGTAGTGGCCACCTGGGGCGATCAGCAGG
CCATTGCAATCAAAGCATCATCTTTGGAGGATCTCGATCAGGAACTTGTTGAGTCAACCA
TCTTTGTGTTGAATCCGGGGTACCTCTGGATGTTCACCAATTGTATTTCGTCTGCATTGT
TCGTTTTGATTATGCGGAAGAGAATTCGGCTGACTAACTTTAAAGACTATGATACTATGT
TTTATAACAACGTTCTGGCATTGCCTTTGCTGCTAGTCTTTTCCTTCATTATGGAAGATT
GGTCCACAAAGAATTTGTCTGTGAACTTGTCCGCCGACTCACTGGCAGCAATGGTCATCA
GTGGGCTCATGTCCGTGGGGATATCGTACTGTTCCGGCTGGTGTGTTCGTGTAACTTCCT
CTACAACGTATTCTATGGTTGGTGCTTTGAACAAATTGCCCATAGCGTTGGCGGGATTGG
TGTTCTTTGACGCTCCAAAAAACTTTTTGTCCTTCTTTTCTATCTTTCTAGGATTTCTGT
CTGGCCTGCTGTACGCTGTGGCTAAACAGAAAAAGATACAACAGCAAAAAGTTCTAGCAG
CTACTCTTGAGAAGTAGTACATTCTTCATTTGCTCAAGCAAAATATACATTTATATTCAT
TTATATGGGGTCTTCTTTGTATTTGTTTTAGGTTATTCCTTTTTTTATGTTACATATTAT
GTCAGCATCGTTTTATGAAATATATTCATATATAATTTTTCAAGTAAATAGCAATAAAGT
GATAAAATTTTGTTAGACGCACAAAAGGGCAGTGTCACAA
Chr coordinates Chr V from 228252-226858
w3c xhtml validator w3c css validator