Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HVG1
Systematic Name YER039C
Alias YEM9
Strain S288c
Description Protein of unknown function, has homology to Vrg4p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HVG1 YER039C
AAAGTCCCAAAGTTGTGCAATTTCACCATTTTGTTGGTTGGATGCGGCTATGTCGATGGG
CTGAGTTGTGGCAAGTGAATCAAACATCGCAATATCATCATCCATATGATTGGTAGCTGG
TGTGGTGTCCTTGACCGTCTTAGTAGTCACGCTGGTCGTGGCAGCTGCTGTAAAAGGAGA
CACGAAGTCCGTAAAATATAAATCATCGGGCAGTGCCTCCAGCATTGAGTCGAATGTGCC
GCCGTTTAATCCACTGGCAAATGCTATATCCTCCTCGTTTTCACCGGTGTTGCCACTACT
CTGGCTCCTACTGTCACCAGTTTGTCTCGGCTCTTCATTACTTCGACCATGCACGTCCAG
ATGACTATTCAGCAGGTCGTACAGCTTCGAATTTTCGGGGTCGTCTTGCATTTGTTTGTT
GGTGGGGGAAAAGGGGGCCCTGTGCTCTCTCTCGTCTCTCTTTCTTACACACTCTGTTAT
TGTGGGATGGGCTACTGCGCTGACATTAGCTTACCACTCTTGAACATCTTTCTCTGTCTT
GCAAGATGACTCTTTCCACTCTCTCAGCATTGCCATGTCACTTTCTTTCGGGAACCTGTC
CGCCGGGTAATAGAGCAAAAAATGTGAATATATCATATTAAGAATGTTTAAAGGGCCAGG
TAGAGATAGAGTACAAGAATGGAAGGTTGAAAAGCTGTAAAGAGATCAAGAAGGTGTGGT
AATTATGAGCAAGCATAAGCATGAATGGACGGAATCAGTGGCCAACTCTGGGCCGGCTTC
AATCTTATCTTACTGCGCGTCCTCGATTTTGATGACAGTAACGAACAAATTCGTGGTTAA
CCTGGACAACTTTAACATGAACTTTGTGATGTTGTTTGTACAATCACTGGTGTGCACTGT
GACGCTATGTATCCTACGAATTGTAGGCGTTGCTAATTTTTGATCTTTGAACAGGACAGA
TGTAAAAAACTGGTTTCCAATTTCTTTGCTGCTCGTATTG
Chr coordinates Chr V from 229205-228456
w3c xhtml validator w3c css validator