Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER039C-A
Systematic Name YER039C-A
Strain S288c
Description Putative protein of unknown function; YER039C-A is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER039C-A YER039C-A
GTTCATAGCGGATGAAGATGAGTTGTTGTTTTGTAGTTTGTAGATGTTGAAGGAATGGTG
GGACTGCGCATTAGTATTTGAGTTGTTATTGATAGATGGCTGGTTGATGTTGCTGTTGGA
CGTGCTGGAATTATACGGGAACAGTGAGGATTTGGAGACGCTGTTGCCGAGGGAACCGTG
GTTGTATTGCGGTATGTCGGAAGTAAAGCTGTTAGGAGCACTAATAGTAGCTGAACCGCT
CGAGTTGCTGGGCGTCATGTTGAATTGGTCCACGTTAAAGTCCCAAAGTTGTGCAATTTC
ACCATTTTGTTGGTTGGATGCGGCTATGTCGATGGGCTGAGTTGTGGCAAGTGAATCAAA
CATCGCAATATCATCATCCATATGATTGGTAGCTGGTGTGGTGTCCTTGACCGTCTTAGT
AGTCACGCTGGTCGTGGCAGCTGCTGTAAAAGGAGACACGAAGTCCGTAAAATATAAATC
ATCGGGCAGTGCCTCCAGCATTGAGTCGAATGTGCCGCCGTTTAATCCACTGGCAAATGC
TATATCCTCCTCGTTTTCACCGGTGTTGCCACTACTCTGGCTCCTACTGTCACCAGTTTG
TCTCGGCTCTTCATTACTTCGACCATGCACGTCCAGATGACTATTCAGCAGGTCGTACAG
CTTCGAATTTTCGGGGTCGTCTTGCATTTGTTTGTTGGTGGGGGAAAAGGGGGCCCTGTG
CTCTCTCTCGTCTCTCTTTCTTACACACTCTGTTATTGTGGGATGGGCTACTGCGCTGAC
ATTAGCTTACCACTCTTGAACATCTTTCTCTGTCTTGCAAGATGACTCTTTCCACTCTCT
CAGCATTGCCATGTCACTTTCTTTCGGGAACCTGTCCGCCGGGTAATAGAGCAAAAAATG
TGAATATATCATATTAAGAATGTTTAAAGGGCCAGGTAGAGATAGAGTACAAGAATGGAA
GGTTGAAAAGCTGTAAAGAGATCAAGAAGGTGTGGTAATT
Chr coordinates Chr V from 229481-229263
w3c xhtml validator w3c css validator