Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEI4
Systematic Name YER044C-A
Strain S288c
Description Meiosis-specific protein involved in double-strand break formation during meiotic recombination; required for chromosome synapsis and production of viable spores
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEI4 YER044C-A
CATGGAAAAACGCTCAATTGAATGTGCATCCATGTACTCCAGCCTCTAATTCTTCCGTTT
CCTCTTCTTCTTCCTGCCAAAACATTAATGATCATAATATCGAAAATCAATCCGTCCATT
CTTCAATTTCCCATGGCGTTAATCACCACACTGTTAATAATTCCTGCCAAAATGCCGAGT
TGAATATTTCAAGCAGCCTTCCATACGAATCGAAATGCCCTGATGTCAATTTAACACATG
CCAACTCAAAACCACAATACAAGGATGCCACTTCTGCACTGAAAAACAATATTAATAGTG
AGAAAGACGTACATACCGCGCCCTTCTCCTCTATGCACACTACAGCAACCTTCCAAATAA
AGCAGGAAGCTAGACCCCAAAAAATAGAGAACAATACTGCAGGCTTGAAAGACGGTGCTA
AAGCTTGGAAGCGTGCAAGGCTACTAGAACGAAACAGAATTGCCGCTTCCAAGTGTCGAC
AGAGAAAGAAAATGTCACAATTACAACTTCAAAGGGAATTTGACCAAATAAGCAAAGAAA
ACACAATGATGAAGAAAAAAATTGAAAATTACGAAAAATTGGTTCAAAAAATGAAGAAAA
TTTCGAGGTTGCACATGCAAGAATGCACAATTAATGGTGGTAATAATAGTTATCAAAGCC
TTCAAAACAAGGATAGTGATGTTAACGGGTTTCTGAAAATGATTGAAGAAATGATACGCA
GCTCCAGTCTATATGATGAATAAAAGTATTGCGCATACTTCTTATGGGAGATCCAAATTC
CCAGTACATTAGTTTGACTCTCCTTCCTTAATGTTTTCCTCTGTACGATTATTTATGTTT
AAACGATTTATTTTACTATGTATGTATTTCCTTTCATTTTCTTTCGGAGTCATATATATT
GCTGGGCGGCTAAATGTTTCCGACTTGTAAAAGAAAACATAACAAACATCTTGTAGTTGT
GAAACAGTTTCATTAAATAATCTTTTAGAAGAGTAAGGAC
Chr coordinates Chr V from 239623-238460,239774-239712
w3c xhtml validator w3c css validator