Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VTC1
Systematic Name YER072W
Alias NRF1, PHM4
Strain S288c
Description Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non-autophagic vacuolar fusion; also has mRNA binding activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VTC1 YER072W
AATAATTTAACATGAACATTTTAAGCTGTCCTTGTAAGAAGGCCATGATACAGATTCCCC
CCTGCCCCGAAATGGGGTCTAGGCAACATTGTTCTATAAAGGAACGCAACTTTATGTGGC
AACATTAAAGCAAATACATATCTACTTGTGAAGCCAAAGAATTGTAATTAAATAGCACTC
ATTATTATTTTTGTCTTCTAGTTTATAGTTGAATATACCATCTTTTTTAGATTCCCAGGA
TGCGCCTATATCGTTCTTCAATGAGAAATTAGCGTTTTCTTCGTTGAGTCCTTCAATGTT
CAACGTCGTTACCGAGGCAATATATTTATACAAAGAAGAGTGCTTTTCAAGTTTTTCTAG
GACCAGTTTTATAAGAAGGTTGGAAGTTGATTCGGTCGATAAATTGATTTCATTGTCATC
TTTTAAACTATCATAACTTTCTTGAATTAACGTAACTAGTTTTCTTTCGGGCAGAGGAGA
GTTATCACTCCTTCCATCCTTTATTTCAATCTGCATACTCATTTTTTTGTTGACTTTCGT
AATCACTTACTTTCACTTATCCTAAATAATTTACAGTGCGTTTTGTAAAACTGCAAGACG
GTATCCGCTAATAGAGAGAAGAATACGTATTTTCTAGTAAAGAAATTTACAAAAAAGGAG
GTATATTGGCATCGCTATTTTCGGATAGAATGGCAAGAGCGATTAAGTATAGCAAACTGG
GAAATGTATAGAGACAAGAAATAATGAGACTCTCTCTTCAAGTATCTTTGAGCACGTATC
AGATAACTAATGGTTATATCGCTTGTTACGGTCGGTGATACTTCACTTTGAAATAGATAT
TAGCACGTGTCTCGGAGAGAAGAAAATGAATGCTGCATTATACAAAATAGATAACAGTAT
TTAAGAGTCCATATTTCCATAACCAGCGACTTGCATACACGTAACATACGATTTACTACA
TTATCGAATACGATTAAACACTACGCCAGATTTCCACAAT
Chr coordinates Chr V from 302806-303195
w3c xhtml validator w3c css validator