Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER138W-A
Systematic Name YER138W-A
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YER138W-A YER138W-A
ATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAA
TCCTCGAGGAGAACTTCTAGTATATCTACATACCTAATATTATAA
Promoter Sequence
Download FASTA
>YER138W-A YER138W-A
CAATTTGGAAAGTCATTAGGTGAGGTTAACATTGGTGGTGGTCTGACATATTTTTTAGTG
GATGTCATATCAGAGTCCGCTGAGGATGAATCAGTAAATGTATTACCTGACTCAGGTGAT
GGAGTGCTCAGAGGCGTTCCAACTGATGATGGATACTGCGGAAACTGTGATTGTGGCCCA
GGTGGAAAGTACATAGGCGACATTTGATAAGGTGTATACGGAATCATAGATGGGTGTCCG
TAAAATGACCAACCAGATGGATTGGCTTGGTTTTGGGTCATCATGCACTGCTGTGGGTAC
GGCCCATTCTGTGGAGGTGGTACTGAAGCAGGTTGAGGAGAGGCATGATGGGGGTTCTCT
GGAACAGCTGATGAAGCAGGTGTTGTTGTCTGTTGAGAGTTAGCCTTAGTGGAAGCCTTC
TCACATTCTTCTGTTTTGGAAGCTGAAACGTCTAACGGATCTTGATTTGTGTGGACTTCC
TTAGAAGTAACCGAAGCACAGGCGCTACCATGAGAAATGGGTGAATGTTGAGATAATTGT
TGGGATTCCATTGTTGATAAAGGCTATAATATTAGGTATACAGAATATACTAGAAGTTCT
CCTCGAGGATATAGGAATCCTCAAAATGGAATCTATATTTCTACATACTAATATTACGAT
TATTCCTCATTCCGTTTTATATGTTTATATTCATTGATCCTATTACATTATCAATCCTTG
CGTTTCAGCTTCCACTAATTTAGATGACTATTTCTCATCATTTGCGTCATCTTCTAACAC
CGTATATGATAATATACTAGTAATGTAAATACTAGTTAGTAGATGATAGTTGATTTCTAT
TCCAACACATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTAGA
AGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATT
GATAATGTAATAGGATCAATGAATATTAACATATAAAACG
Chr coordinates Chr V from 449474-449578
w3c xhtml validator w3c css validator