Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER189W
Systematic Name YER189W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER189W YER189W
TGGATATGGGTAATTGGAGGGTAACGGTTATGGTGGACGGTGGGTTGGTGGTAGGAAGTA
GAGGGATGGATGGTGGTTGGGGTGGTATGGTTGAATGGGACAGGGTAACGAGTGGACAGT
AGGGTAATGGAGGGTAAGTTTGGAGACAGGTTGGCGAGGGTTAGATTAGGATAGCATATC
TATGTCACCTTATTGCATGCTGGATGGTGTTAGACAAGGCCGTAGGGACATATAGCATCT
AGGAAGTAACCTTGTACGAAAATAGGCAATATTTCCTGTTTGACGCAGATTTTAGCCCAA
AGATCTAGCGTTAAGGAATTTTTTTATAGTGGGACATTGCAAACCAAGGAAGTAACTTGA
TACGTCGTTGGTGAATGGGTCTGTTTTCTTATTCGGCGGGGTAATACATTTTGAGGGAAG
GTTGTCTGTCTGACGCGCCATATGTAGGTACGCCAAAAAGGGCTCCTTTACTTCGAAGCG
CGAGGTCGTATACCTAATAAGGAAATGTAATTTATAACTTTTTATTATATTGGTCTTTTC
GAGAGCGGAAGAAGTTGTAGGCTAAGCGCAGGCTAAGCGTAGGTCCATGTTTAAAGTATC
CAAGAGAATATCCACGAAGCGGCTGAGCAACGAACAGAATCCTGGTTCTCCTCGACTAAG
CAGATAGTTAAGATACTGTGCACCATGGAAATTGAAAACGAACGTACGTACCGACTACTT
TATTTTTGCAGGCCGGAAATCAAGCGATGAATGAGACATCCTTCTGTTTTCTATGTTGTG
CTTGAAGGGGACAGACAGTCGCTTATCTTAGTGAGATTTTGTTTGCTTTTGCTGCACCTG
CATAGCGCAGATTCTGCATCTTCTCAATAGCTTAATTATTACATTCTTAGATGATGATAA
GACGGAAACTGGAGAATCTTTTGTTTATATTGATGGATTTCTTGTCAAAAAGCATAACAA
TCAACATACTATTGTTAATTTCGAAACTTACAAAAATAAA
Chr coordinates Chr V from 571155-571523
w3c xhtml validator w3c css validator