Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YRF1-2
Systematic Name YER190W
Alias YRF1
Strain S288c
Description Helicase encoded by the Y' element of subtelomeric regions, highly expressed in the mutants lacking the telomerase component TLC1; potentially phosphorylated by Cdc28p; induced by treatment with 8-methoxypsoralen and UVA irradiation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YRF1-2 YER190W
ATAGTGGGACATTGCAAACCAAGGAAGTAACTTGATACGTCGTTGGTGAATGGGTCTGTT
TTCTTATTCGGCGGGGTAATACATTTTGAGGGAAGGTTGTCTGTCTGACGCGCCATATGT
AGGTACGCCAAAAAGGGCTCCTTTACTTCGAAGCGCGAGGTCGTATACCTAATAAGGAAA
TGTAATTTATAACTTTTTATTATATTGGTCTTTTCGAGAGCGGAAGAAGTTGTAGGCTAA
GCGCAGGCTAAGCGTAGGTCCATGTTTAAAGTATCCAAGAGAATATCCACGAAGCGGCTG
AGCAACGAACAGAATCCTGGTTCTCCTCGACTAAGCAGATAGTTAAGATACTGTGCACCA
TGGAAATTGAAAACGAACGTACGTACCGACTACTTTATTTTTGCAGGCCGGAAATCAAGC
GATGAATGAGACATCCTTCTGTTTTCTATGTTGTGCTTGAAGGGGACAGACAGTCGCTTA
TCTTAGTGAGATTTTGTTTGCTTTTGCTGCACCTGCATAGCGCAGATTCTGCATCTTCTC
AATAGCTTAATTATTACATTCTTAGATGATGATAAGACGGAAACTGGAGAATCTTTTGTT
TATATTGATGGATTTCTTGTCAAAAAGCATAACAATCAACATACTATTGTTAATTTCGAA
ACTTACAAAAATAAAATGAAAGTTTCCGATAGGCGTAAGTTTGAAAAAGCAAACTTTGAC
GAGTTTGAGTCGGCTCTAAATAACAAAAACGACTTGGTACATTGTCCCTCAATAACTTTA
TTTGAATCGATCCCCACGGAAGTGCGGTCATTCTACGAAGACGAAAAGTCTGGCCTAATC
AAAGTGGTAAAATTCAGAACTGGTGCAATGGATAGGAAAAGGTCTTTTGAAAAAATTGTC
ATTTCCGTCATGGTCGGGAAAAATGTACAAAAGTTCCTGACGTTTGTTGAAGACGAACCA
GATTTCCAGGGCGGACCAATCCCTTCAAACAAACCACGTG
Chr coordinates Chr V from 571480-576525
w3c xhtml validator w3c css validator