Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HXT10
Systematic Name YFL011W
Strain S288c
Description Putative hexose transporter, expressed at low levels and expression is repressed by glucose
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>HXT10 YFL011W
ATGGTTAGTTCAAGTGTTTCCATTTTGGGGACTAGCGCCAAGGCATCCACTTCTCTAAGT
AGAAAGGATGAAATTAAACTAACCCCTGAAACAAGGGAAGCTAGCTTGGACATTCCATAC
AAACCCATTATTGCATACTGGACGGTGATGGGTCTCTGTCTGATGATTGCCTTTGGTGGA
TTCATTTTTGGTTGGGATACAGGAACCATTTCAGGGTTTATTAACCAAACAGATTTCAAG
AGAAGGTTTGGTGAGTTACAAAGGGACGGCAGTTTTCAACTATCAGATGTCAGGACAGGG
CTAATTGTCGGTATCTTCAACATAGGTTGTGCTTTAGGTGGCCTAACGCTGGGACGCCTG
GGCGATATTTATGGGCGTAAAATCGGCTTAATGTGTGTTATACTGGTGTATGTTGTTGGT
ATCGTGATCCAGATTGCTTCCTCTGACAAATGGTATCAATATTTTATTGGTAGAATTGTT
TCTGGAATGGGTGTTGGAGGTGTTGCTGTGCTGTCGCCAACTTTGATCTCAGAAATTTCC
CCAAAGCACCTAAGAGGCACTTGTGTCTCTTTTTACCAGCTAATGATTACCCTTGGAATT
TTCTTGGGCTACTGTACCAATTATGGTACAAAGAAATATTCAAATTCAATACAGTGGCGG
GTTCCCTTGGGTTTGTGTTTTGCGTGGGCAATCTTTATGGTGATTGGAATGGTTATGGTT
CCGGAATCGCCCAGATATTTAGTAGAAAAAGGTAAGTATGAAGAAGCTAGAAGGTCTTTG
GCCAAATCAAACAAGGTCACAGTTACTGATCCAGGCGTTGTTTTTGAGTTTGATACTATA
GTTGCAAATATGGAATTAGAAAGGGCTGTTGGAAATGCCAGTTGGCACGAACTCTTCTCA
AATAAAGGAGCAATTCTACCAAGGGTAATAATGGGAATCGTTATCCAGTCACTGCAACAG
CTTACTGGCTGTAATTATTTTTTCTACTACGGCACGACCATTTTCAATGCTGTTGGAATG
CAAGACTCTTTCGAGACTTCCATTGTCCTTGGGGCTGTTAATTTTGCTTCTACATTTGTT
GCACTATACATTGTGGATAAATTTGGGCGTCGAAAATGTTTATTGTGGGGGTCTGCCTCG
ATGGCAATTTGTTTCGTCATATTCGCCACCGTTGGCGTCACTAGATTATGGCCACAAGGG
AAAGACCAACCTTCTTCGCAAAGTGCTGGTAATGTTATGATCGTTTTTACTTGTTTCTTC
ATTTTCTCTTTTGCCATTACTTGGGCTCCTATCGCCTATGTCATTGTGGCAGAAACTTAT
CCATTAAGAGTTAAAAATCGTGCCATGGCCATTGCGGTTGGTGCGAACTGGATGTGGGGT
TTCTTGATTGGATTTTTCACACCCTTTATCACTAGATCCATAGGATTTTCTTATGGCTAT
GTTTTCATGGGTTGCTTAATCTTTTCGTACTTCTACGTTTTCTTCTTTGTTTGCGAAACA
AAGGGATTAACTCTGGAGGAAGTTAATGAAATGTACGAAGAAAGAATAAAGCCATGGAAG
TCCGGAGGTTGGATTCCCAGTTCTAGAAGAACACCACAACCAACAAGCAGTACACCATTA
GTTATTGTTGATAGTAAATAA
Promoter Sequence
Download FASTA
>HXT10 YFL011W
AGAAATGAAATCTCTTTCGATGAGCAATGGTCTTATGGATAATTTGATAGACATATGAAA
AAGTCAAAAGTTTTTTTGGCCATATGCAGTAAAAACTTACCCTTCAAATTGCAAAACCAT
TAGTTTTATTATATTTTTTTTTTTTTCTTTCATTGAAGTATACACGAAATCCCATACGCA
AATAAACAGTCGTTGTATCATCAATTTCGGCTGTCTGGATGGCGACTACGAGAGGAAGCT
TGCTTGCCATGATAGGACCAATCTCAATTTTTAATTTTTCATTAACTAGCTAATTTTCTA
TAATGCTCTAAGTTTCCTTTTTCGTTTTGTTTCTTTATAGTGATGATGCTGTTATTGTGA
CGCTATCAAATCATATACTGTCATCAATCCTCATCTCATCGGCTCCGGAACGCGTTGAAT
ATGTTGTTAAACAAGCTCTTTATAGCTAGCTATAGTAGAAAAGGAAGGAAAGAAGTCTAA
TCGCTGTATTATCGACTGACAAGGGTTGTCAGTTGCCTTCTTTTATTTTTTGTACTCCCC
TGAATCGAGCGGATGTATTTTTTAACAAAGTATTCAGAATTGTTTTTGTATAATCAAAAT
TTGTCGACGCTAAGAAAATGACGGACGTCGTAATTCCGCTACTAGGTTTTGTGTGCTCAT
CGATATTTGACACCTATTTTCGACACTTTTAAGGTTATATACTTTGTTTCGGATGTGGGG
TACACTCAGTTGACTGATTATGAAAGATATGGCGTAGCCGTTGGGTTAGGGTTATTACAC
AGAAATGAATTATACCAGTGAAATTATTCTCTTTATGTTTGTTCCTACATGTTTTCCAAT
CAGAAGGAATTGTTATATAAGGACACAAGAAATGTGTTGGTACGCTCTGCGCCTCAATGA
CGGTTTATCTATCTAAAACTATTTCTTTCTCGTAATAAAAATACAATAAATAATTAATAA
TAATATAGTTGATCGATATAACAAAAAAATAACAGCGAGG
Chr coordinates Chr VI from 112345-113985
w3c xhtml validator w3c css validator